Incidental Mutation 'R1268:Mab21l3'
ID151206
Institutional Source Beutler Lab
Gene Symbol Mab21l3
Ensembl Gene ENSMUSG00000044313
Gene Namemab-21-like 3 (C. elegans)
SynonymsBC037703
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location101813076-101848959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101835047 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 66 (E66K)
Ref Sequence ENSEMBL: ENSMUSP00000112730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061831] [ENSMUST00000118411]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061831
AA Change: E66K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059212
Gene: ENSMUSG00000044313
AA Change: E66K

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118411
AA Change: E66K

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112730
Gene: ENSMUSG00000044313
AA Change: E66K

DomainStartEndE-ValueType
Mab-21 124 422 3.17e-104 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Mab21l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mab21l3 APN 3 101823455 missense probably damaging 0.99
IGL01123:Mab21l3 APN 3 101835130 missense probably benign 0.06
IGL01997:Mab21l3 APN 3 101818639 missense probably damaging 0.99
IGL02423:Mab21l3 APN 3 101818729 missense probably damaging 1.00
IGL02546:Mab21l3 APN 3 101823308 missense probably damaging 1.00
R1803:Mab21l3 UTSW 3 101835130 missense probably benign 0.06
R2056:Mab21l3 UTSW 3 101815153 missense possibly damaging 0.55
R2104:Mab21l3 UTSW 3 101823428 missense probably benign 0.31
R3107:Mab21l3 UTSW 3 101826796 missense probably damaging 1.00
R3405:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R3406:Mab21l3 UTSW 3 101823531 missense probably damaging 1.00
R5715:Mab21l3 UTSW 3 101823407 missense probably benign 0.36
R6612:Mab21l3 UTSW 3 101818645 missense possibly damaging 0.55
R7183:Mab21l3 UTSW 3 101815153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAGAACGAGGCATCTATGGC -3'
(R):5'- CCAGGCGGCTTGTTTGCAATTTC -3'

Sequencing Primer
(F):5'- GCATCTATGGCCTCCAGAAG -3'
(R):5'- TCTACAGTTCCCTGAAAGATGGC -3'
Posted On2014-01-29