Incidental Mutation 'R1268:Ulk1'
ID151208
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110790277 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 610 (S610P)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect probably damaging
Transcript: ENSMUST00000031490
AA Change: S604P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: S604P

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect probably damaging
Transcript: ENSMUST00000200299
AA Change: S610P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: S610P

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Meta Mutation Damage Score 0.1703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1586:Ulk1 UTSW 5 110789516 missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2276:Ulk1 UTSW 5 110788162 missense probably benign 0.00
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2311:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2312:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110790393 missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
R7724:Ulk1 UTSW 5 110792404 missense probably benign 0.44
R7751:Ulk1 UTSW 5 110809212 missense probably damaging 1.00
R7823:Ulk1 UTSW 5 110798914 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGCCACAGCTTAGCAGATAGAC -3'
(R):5'- TGTGCCTGAGCACTCTCCAAGAAC -3'

Sequencing Primer
(F):5'- TCCCAGTTCACAAAGGGTG -3'
(R):5'- TCCAAGAACCACTGGGCTG -3'
Posted On2014-01-29