Incidental Mutation 'R1268:Gnat1'
ID151214
Institutional Source Beutler Lab
Gene Symbol Gnat1
Ensembl Gene ENSMUSG00000034837
Gene Nameguanine nucleotide binding protein, alpha transducing 1
SynonymsGnat-1, Ird1, irdr, Ird2, transducin, Tralpha
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107674474-107679712 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 107675877 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000192271]
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195849
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in rods. This gene is also expressed in other cells, and has been implicated in bitter taste transduction in rat taste cells. Mutations in this gene result in autosomal dominant congenital stationary night blindness. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruption of this gene display retinal degeneration with age and abnormal electrophysiology of the rods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Gnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Gnat1 APN 9 107679434 unclassified probably null
IGL01514:Gnat1 APN 9 107676301 missense possibly damaging 0.56
R0730:Gnat1 UTSW 9 107679463 missense probably damaging 1.00
R1054:Gnat1 UTSW 9 107677439 missense probably damaging 1.00
R1440:Gnat1 UTSW 9 107676965 missense probably damaging 1.00
R1824:Gnat1 UTSW 9 107676575 missense probably damaging 1.00
R4964:Gnat1 UTSW 9 107677234 missense probably benign 0.05
R4966:Gnat1 UTSW 9 107677234 missense probably benign 0.05
R6355:Gnat1 UTSW 9 107677424 missense probably benign 0.03
R7035:Gnat1 UTSW 9 107676628 unclassified probably benign
R7218:Gnat1 UTSW 9 107675985 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTGAGGGGACTACAGGGCTACAG -3'
(R):5'- GACCTAACACTTACGAGGATGCCG -3'

Sequencing Primer
(F):5'- cagggctacagggctgc -3'
(R):5'- GGCAACTACATCAAAGTGCAG -3'
Posted On2014-01-29