Incidental Mutation 'R1268:Ntn1'
ID151217
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Namenetrin 1
SynonymsNetrin-1
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock #R1268 (G1)
Quality Score144
Status Validated
Chromosome11
Chromosomal Location68209364-68400823 bp(-) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) TCCTCGGC to TC at 68213133 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
Predicted Effect probably benign
Transcript: ENSMUST00000021284
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108674
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGACCACTGTGCCATTCTGTTCC -3'
(R):5'- TTCACCGTGAACATCATCTCCGTG -3'

Sequencing Primer
(F):5'- AGGGAAGCGCATCTCTGTTC -3'
(R):5'- TCATCTCCGTGTACAAGCAGG -3'
Posted On2014-01-29