Incidental Mutation 'R1268:Rnaseh2b'
ID151222
Institutional Source Beutler Lab
Gene Symbol Rnaseh2b
Ensembl Gene ENSMUSG00000021932
Gene Nameribonuclease H2, subunit B
SynonymsDleu8, 1110019N06Rik, 2610207P08Rik
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location62292589-62372992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62372455 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 303 (K303N)
Ref Sequence ENSEMBL: ENSMUSP00000022499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022499]
PDB Structure
mouse RNase H2 complex [X-RAY DIFFRACTION]
The structure of the human RNase H2 complex defines key interaction interfaces relevant to enzyme function and human disease [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022499
AA Change: K303N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022499
Gene: ENSMUSG00000021932
AA Change: K303N

DomainStartEndE-ValueType
Pfam:RNase_H2-Ydr279 14 298 6.8e-58 PFAM
Meta Mutation Damage Score 0.1786 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RNase H2 is composed of a single catalytic subunit (A) and two non-catalytic subunits (B and C) and specifically degrades the RNA of RNA:DNA hybrids. The protein encoded by this gene is the non-catalytic B subunit of RNase H2, which is thought to play a role in DNA replication. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Aicardi-Goutieres syndrome type 2 (AGS2). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality associated with reduced cell proliferation and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Rnaseh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rnaseh2b APN 14 62365257 critical splice acceptor site probably null
IGL02475:Rnaseh2b APN 14 62346615 missense probably damaging 1.00
R1698:Rnaseh2b UTSW 14 62353632 missense probably benign 0.02
R2138:Rnaseh2b UTSW 14 62361345 missense probably benign
R2304:Rnaseh2b UTSW 14 62361389 missense probably damaging 1.00
R3896:Rnaseh2b UTSW 14 62360457 splice site probably benign
R4717:Rnaseh2b UTSW 14 62353626 missense probably damaging 1.00
R5160:Rnaseh2b UTSW 14 62353531 nonsense probably null
R6360:Rnaseh2b UTSW 14 62361419 missense probably damaging 0.98
R8029:Rnaseh2b UTSW 14 62353548 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCACCCTCAAAATGATTCCCAGAG -3'
(R):5'- AAGTCACAGCGCAGCAAGTGTC -3'

Sequencing Primer
(F):5'- GTGCTCATTGAACCAAGATTCAGG -3'
(R):5'- TGTCTGCAGGATGCGAAA -3'
Posted On2014-01-29