Incidental Mutation 'R1268:Igsf11'
ID151225
Institutional Source Beutler Lab
Gene Symbol Igsf11
Ensembl Gene ENSMUSG00000022790
Gene Nameimmunoglobulin superfamily, member 11
SynonymsBT-IgSF, 1700025L02Rik
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38892671-39027159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39024854 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 257 (T257A)
Ref Sequence ENSEMBL: ENSMUSP00000110354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023478] [ENSMUST00000114706]
Predicted Effect probably benign
Transcript: ENSMUST00000023478
AA Change: T316A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023478
Gene: ENSMUSG00000022790
AA Change: T316A

DomainStartEndE-ValueType
IG 29 143 4.32e-8 SMART
IGc2 156 222 2.54e-5 SMART
transmembrane domain 240 262 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
low complexity region 301 319 N/A INTRINSIC
Blast:DEXDc 355 425 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114706
AA Change: T257A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110354
Gene: ENSMUSG00000022790
AA Change: T257A

DomainStartEndE-ValueType
IG_like 11 84 3.12e1 SMART
IGc2 97 163 2.54e-5 SMART
transmembrane domain 181 203 N/A INTRINSIC
low complexity region 212 227 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
Blast:DEXDc 296 366 5e-14 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IGSF11 is an immunoglobulin (Ig) superfamily member that is preferentially expressed in brain and testis. It shares significant homology with coxsackievirus and adenovirus receptor (CXADR; MIM 602621) and endothelial cell-selective adhesion molecule (ESAM).[supplied by OMIM, Apr 2005]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted synaptic transmission and plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Igsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Igsf11 APN 16 39008917 missense probably damaging 1.00
R0139:Igsf11 UTSW 16 39008878 missense probably damaging 1.00
R0348:Igsf11 UTSW 16 39008817 missense probably benign 0.01
R4494:Igsf11 UTSW 16 39011341 missense possibly damaging 0.46
R4791:Igsf11 UTSW 16 39024864 missense probably damaging 0.99
R5387:Igsf11 UTSW 16 39022423 missense probably damaging 1.00
R5572:Igsf11 UTSW 16 39024932 missense probably damaging 0.97
R6150:Igsf11 UTSW 16 39023349 missense probably damaging 0.96
R6340:Igsf11 UTSW 16 39008974 missense probably benign
R6815:Igsf11 UTSW 16 39008881 missense probably benign 0.02
R7521:Igsf11 UTSW 16 39008912 missense probably damaging 1.00
R7533:Igsf11 UTSW 16 39008874 missense probably benign 0.07
R7732:Igsf11 UTSW 16 39008798 missense probably damaging 0.99
R7838:Igsf11 UTSW 16 39007203 missense possibly damaging 0.65
R7921:Igsf11 UTSW 16 39007203 missense possibly damaging 0.65
X0026:Igsf11 UTSW 16 39007286 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCATCAGCACACCACAATGGTTCTC -3'
(R):5'- TGGACCCAAAACCAGATGGTTCCC -3'

Sequencing Primer
(F):5'- acacacgagagagagtctagag -3'
(R):5'- AGATGGTTCCCATTTGCATAGATTG -3'
Posted On2014-01-29