Incidental Mutation 'R1268:Brpf3'
ID151228
Institutional Source Beutler Lab
Gene Symbol Brpf3
Ensembl Gene ENSMUSG00000063952
Gene Namebromodomain and PHD finger containing, 3
Synonyms
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28801090-28838546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28836556 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1160 (T1160A)
Ref Sequence ENSEMBL: ENSMUSP00000004985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004985]
Predicted Effect probably damaging
Transcript: ENSMUST00000004985
AA Change: T1160A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: T1160A

DomainStartEndE-ValueType
Pfam:EPL1 48 194 8.4e-38 PFAM
PHD 214 260 7.07e-5 SMART
PHD 324 387 4.74e-6 SMART
low complexity region 405 436 N/A INTRINSIC
Blast:BROMO 491 534 7e-21 BLAST
low complexity region 558 577 N/A INTRINSIC
BROMO 586 694 4.93e-39 SMART
low complexity region 777 792 N/A INTRINSIC
low complexity region 813 823 N/A INTRINSIC
PWWP 1073 1156 2.07e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156029
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Brpf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Brpf3 APN 17 28836700 utr 3 prime probably benign
IGL01397:Brpf3 APN 17 28817632 missense probably benign 0.22
IGL01608:Brpf3 APN 17 28821517 missense probably benign 0.00
IGL02073:Brpf3 APN 17 28807396 missense probably benign
IGL02540:Brpf3 APN 17 28828354 missense probably damaging 1.00
IGL02838:Brpf3 APN 17 28835784 missense probably benign 0.19
IGL02888:Brpf3 APN 17 28828391 missense probably damaging 1.00
IGL02969:Brpf3 APN 17 28821305 missense probably benign 0.05
IGL03036:Brpf3 APN 17 28824048 missense possibly damaging 0.89
IGL03084:Brpf3 APN 17 28835777 missense probably damaging 0.98
R0448:Brpf3 UTSW 17 28806036 missense probably benign 0.10
R0898:Brpf3 UTSW 17 28806990 missense possibly damaging 0.65
R1639:Brpf3 UTSW 17 28824068 critical splice donor site probably null
R1754:Brpf3 UTSW 17 28821323 missense probably benign 0.00
R1867:Brpf3 UTSW 17 28807368 missense probably benign
R1954:Brpf3 UTSW 17 28806559 missense probably benign
R2000:Brpf3 UTSW 17 28821557 missense probably benign 0.20
R2064:Brpf3 UTSW 17 28821364 missense probably benign
R2209:Brpf3 UTSW 17 28828420 missense probably damaging 0.98
R2413:Brpf3 UTSW 17 28805950 start gained probably benign
R3977:Brpf3 UTSW 17 28807042 missense possibly damaging 0.49
R4067:Brpf3 UTSW 17 28821259 missense probably benign
R4291:Brpf3 UTSW 17 28823975 missense probably benign 0.00
R4369:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4371:Brpf3 UTSW 17 28836620 missense probably damaging 1.00
R4741:Brpf3 UTSW 17 28817784 missense possibly damaging 0.50
R4773:Brpf3 UTSW 17 28821259 missense probably benign 0.00
R4824:Brpf3 UTSW 17 28806486 missense probably benign
R5360:Brpf3 UTSW 17 28810562 missense probably benign
R5923:Brpf3 UTSW 17 28806636 missense possibly damaging 0.90
R6181:Brpf3 UTSW 17 28810581 missense probably damaging 1.00
R6278:Brpf3 UTSW 17 28821284 missense probably benign 0.00
R6702:Brpf3 UTSW 17 28810659 missense probably benign 0.01
R6884:Brpf3 UTSW 17 28831350 missense probably benign 0.03
R6920:Brpf3 UTSW 17 28823996 missense probably benign 0.34
R6976:Brpf3 UTSW 17 28835777 missense probably damaging 0.98
R7099:Brpf3 UTSW 17 28806637 missense probably benign 0.06
R7108:Brpf3 UTSW 17 28817125 missense probably benign 0.01
R7193:Brpf3 UTSW 17 28836691 makesense probably null
R7316:Brpf3 UTSW 17 28814686 missense probably damaging 1.00
R7326:Brpf3 UTSW 17 28806293 missense probably benign 0.00
R7403:Brpf3 UTSW 17 28821356 missense probably benign
R7666:Brpf3 UTSW 17 28810572 missense possibly damaging 0.83
R7686:Brpf3 UTSW 17 28806934 missense probably damaging 0.98
R7691:Brpf3 UTSW 17 28806831 missense probably damaging 1.00
R8054:Brpf3 UTSW 17 28836597 missense probably damaging 1.00
Z1177:Brpf3 UTSW 17 28821478 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAGCTGTCCGACTTTGCAC -3'
(R):5'- GCCTGCCATTAGAAAGAAGCTGCC -3'

Sequencing Primer
(F):5'- GTCCGACTTTGCACTCCTCTAC -3'
(R):5'- TTCTCATGCCTCAGGGACAG -3'
Posted On2014-01-29