Incidental Mutation 'R1268:Rbm27'
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene NameRNA binding motif protein 27
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosomal Location42275353-42341542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42333302 bp
Amino Acid Change Serine to Proline at position 866 (S866P)
Ref Sequence ENSEMBL: ENSMUSP00000041688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
Predicted Effect probably damaging
Transcript: ENSMUST00000046972
AA Change: S866P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491
AA Change: S866P

Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091920
AA Change: S910P

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491
AA Change: S910P

Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Meta Mutation Damage Score 0.0933 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42319814 missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42301840 missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42319913 missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42333399 critical splice donor site probably null
IGL03085:Rbm27 APN 18 42327524 splice site probably benign
IGL03249:Rbm27 APN 18 42301747 missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42305716 missense probably damaging 0.99
messenger UTSW 18 42333403 splice site probably null
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0111:Rbm27 UTSW 18 42305672 splice site probably benign
R0122:Rbm27 UTSW 18 42313968 intron probably benign
R0707:Rbm27 UTSW 18 42326026 critical splice donor site probably null
R1253:Rbm27 UTSW 18 42301774 missense probably damaging 0.99
R1317:Rbm27 UTSW 18 42324051 splice site probably benign
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42325957 missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42292112 splice site probably benign
R3123:Rbm27 UTSW 18 42327165 missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42292112 splice site probably benign
R3712:Rbm27 UTSW 18 42292112 splice site probably benign
R4616:Rbm27 UTSW 18 42301775 missense probably damaging 0.96
R4839:Rbm27 UTSW 18 42327445 missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42338444 missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42327210 missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42317666 missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42300385 missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42327505 missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42333318 missense probably damaging 1.00
R6499:Rbm27 UTSW 18 42337011 missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42324113 missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42325939 missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42301864 missense probably benign 0.00
R6812:Rbm27 UTSW 18 42333403 splice site probably null
R7162:Rbm27 UTSW 18 42314027 missense unknown
R7606:Rbm27 UTSW 18 42327513 missense probably damaging 1.00
R7904:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
R7987:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
X0065:Rbm27 UTSW 18 42299320 missense possibly damaging 0.70
Z1176:Rbm27 UTSW 18 42333234 frame shift probably null
Z1177:Rbm27 UTSW 18 42338452 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- attccctaaccccctctctc -3'
Posted On2014-01-29