Incidental Mutation 'R1268:Olfr1451'
ID151231
Institutional Source Beutler Lab
Gene Symbol Olfr1451
Ensembl Gene ENSMUSG00000046913
Gene Nameolfactory receptor 1451
SynonymsGA_x6K02T2RE5P-3328502-3329434, MOR202-1
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R1268 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12995014-13000417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12999261 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 92 (Y92H)
Ref Sequence ENSEMBL: ENSMUSP00000146874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063144] [ENSMUST00000207997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063144
AA Change: Y92H

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049885
Gene: ENSMUSG00000046913
AA Change: Y92H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 2.2e-5 PFAM
Pfam:7tm_1 39 289 6.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207997
AA Change: Y92H

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1565 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Crebrf CTTTT CTTT 17: 26,739,596 probably null Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Olfr1451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1451 APN 19 12999319 missense probably damaging 1.00
IGL01301:Olfr1451 APN 19 12999417 missense probably damaging 0.99
IGL01369:Olfr1451 APN 19 12999761 missense possibly damaging 0.78
IGL02098:Olfr1451 APN 19 12999573 missense probably benign 0.00
IGL02106:Olfr1451 APN 19 12999565 missense possibly damaging 0.80
IGL02369:Olfr1451 APN 19 12999708 missense probably damaging 1.00
ANU18:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
R0316:Olfr1451 UTSW 19 12999402 missense probably damaging 1.00
R0926:Olfr1451 UTSW 19 12999190 missense probably damaging 1.00
R0988:Olfr1451 UTSW 19 12999787 missense probably benign 0.39
R1509:Olfr1451 UTSW 19 12999451 missense possibly damaging 0.54
R1991:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2103:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2132:Olfr1451 UTSW 19 12999038 missense probably benign 0.21
R2206:Olfr1451 UTSW 19 12999040 missense probably benign 0.06
R3687:Olfr1451 UTSW 19 12999102 missense probably damaging 1.00
R4077:Olfr1451 UTSW 19 12999871 missense probably damaging 1.00
R4803:Olfr1451 UTSW 19 12999169 missense probably damaging 1.00
R4948:Olfr1451 UTSW 19 12999831 missense probably benign 0.06
R4999:Olfr1451 UTSW 19 12999219 missense probably benign 0.03
R6274:Olfr1451 UTSW 19 12999870 missense probably damaging 0.97
R6843:Olfr1451 UTSW 19 12998998 missense probably benign 0.09
R6928:Olfr1451 UTSW 19 12999838 missense probably damaging 0.99
R6941:Olfr1451 UTSW 19 12999497 missense possibly damaging 0.86
R7485:Olfr1451 UTSW 19 12999558 missense probably benign 0.03
R7611:Olfr1451 UTSW 19 12999067 missense possibly damaging 0.93
R7823:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGGACTAACTGATGACCCAGGC -3'
(R):5'- CTGCATCCATAGAATGGCTGGAGC -3'

Sequencing Primer
(F):5'- GCAGGTTTCCCTTTGTATCATGTTC -3'
(R):5'- GGTCTGACTTCATCTTCAAGACAG -3'
Posted On2014-01-29