Incidental Mutation 'R1269:A430105I19Rik'
ID151235
Institutional Source Beutler Lab
Gene Symbol A430105I19Rik
Ensembl Gene ENSMUSG00000045838
Gene NameRIKEN cDNA A430105I19 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1269 (G1)
Quality Score120
Status Not validated
Chromosome2
Chromosomal Location118754158-118762661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118761390 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 90 (E90K)
Ref Sequence ENSEMBL: ENSMUSP00000051853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059997
AA Change: E90K

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051853
Gene: ENSMUSG00000045838
AA Change: E90K

DomainStartEndE-ValueType
coiled coil region 52 100 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF4594 185 361 1.2e-64 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 535 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151270
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in A430105I19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:A430105I19Rik APN 2 118759689 missense possibly damaging 0.94
IGL03327:A430105I19Rik APN 2 118761670 missense probably damaging 1.00
R1453:A430105I19Rik UTSW 2 118757422 missense possibly damaging 0.91
R1495:A430105I19Rik UTSW 2 118760532 missense probably damaging 1.00
R1529:A430105I19Rik UTSW 2 118761760 critical splice acceptor site probably null
R1765:A430105I19Rik UTSW 2 118760647 missense probably benign 0.02
R4766:A430105I19Rik UTSW 2 118759577 missense probably damaging 1.00
R5445:A430105I19Rik UTSW 2 118759586 missense probably damaging 1.00
R5891:A430105I19Rik UTSW 2 118761383 missense probably damaging 1.00
R5895:A430105I19Rik UTSW 2 118759617 missense probably benign 0.02
R7271:A430105I19Rik UTSW 2 118760683 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TACATGCAGAGCTGTAGGACTGGG -3'
(R):5'- GGCTGTTTACACAGTGGGTTCTCTC -3'

Sequencing Primer
(F):5'- CTTTGGAGAAGATGGCAATAGCTTG -3'
(R):5'- TCAAAGTCTTGGGCACTGGT -3'
Posted On2014-01-29