Incidental Mutation 'R1269:Zfp526'
ID151245
Institutional Source Beutler Lab
Gene Symbol Zfp526
Ensembl Gene ENSMUSG00000046541
Gene Namezinc finger protein 526
SynonymsD030024H03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1269 (G1)
Quality Score148
Status Not validated
Chromosome7
Chromosomal Location25221425-25227507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25224363 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 16 (S16P)
Ref Sequence ENSEMBL: ENSMUSP00000053567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055604] [ENSMUST00000058702] [ENSMUST00000071739] [ENSMUST00000108411] [ENSMUST00000205271]
Predicted Effect probably benign
Transcript: ENSMUST00000055604
AA Change: S16P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053567
Gene: ENSMUSG00000046541
AA Change: S16P

DomainStartEndE-ValueType
ZnF_C2H2 56 78 1.41e0 SMART
low complexity region 79 90 N/A INTRINSIC
ZnF_C2H2 108 130 9.46e0 SMART
ZnF_C2H2 140 163 4.65e-1 SMART
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 200 222 4.72e-2 SMART
coiled coil region 234 254 N/A INTRINSIC
ZnF_C2H2 280 303 1.26e1 SMART
ZnF_C2H2 312 334 3.29e-1 SMART
ZnF_C2H2 339 361 6.78e-3 SMART
ZnF_C2H2 367 389 4.65e-1 SMART
ZnF_C2H2 395 416 3.56e1 SMART
ZnF_C2H2 447 470 8.47e-4 SMART
ZnF_C2H2 477 499 2.05e-2 SMART
ZnF_C2H2 505 527 2.09e-3 SMART
ZnF_C2H2 533 555 5.99e-4 SMART
ZnF_C2H2 578 600 8.22e-2 SMART
low complexity region 610 624 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058702
SMART Domains Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499

DomainStartEndE-ValueType
DED 24 104 6.34e-13 SMART
low complexity region 130 147 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071739
SMART Domains Protein: ENSMUSP00000071654
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 481 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108411
SMART Domains Protein: ENSMUSP00000104049
Gene: ENSMUSG00000057177

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 25 90 N/A INTRINSIC
S_TKc 119 404 3.11e-84 SMART
low complexity region 477 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169914
SMART Domains Protein: ENSMUSP00000126890
Gene: ENSMUSG00000090330

DomainStartEndE-ValueType
low complexity region 77 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190693
Predicted Effect probably benign
Transcript: ENSMUST00000205271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206788
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Other mutations in Zfp526
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Zfp526 APN 7 25225533 missense possibly damaging 0.89
IGL02983:Zfp526 APN 7 25224415 missense probably benign 0.27
IGL03123:Zfp526 APN 7 25224624 missense probably benign
R0456:Zfp526 UTSW 7 25226212 missense probably damaging 1.00
R1542:Zfp526 UTSW 7 25226262 missense probably benign 0.12
R1668:Zfp526 UTSW 7 25225542 missense probably benign 0.15
R1742:Zfp526 UTSW 7 25224514 missense possibly damaging 0.93
R1870:Zfp526 UTSW 7 25225169 missense possibly damaging 0.67
R3791:Zfp526 UTSW 7 25226203 missense probably damaging 0.98
R4755:Zfp526 UTSW 7 25225639 missense probably benign 0.00
R4833:Zfp526 UTSW 7 25225870 missense probably damaging 1.00
R5549:Zfp526 UTSW 7 25225684 missense possibly damaging 0.82
R5853:Zfp526 UTSW 7 25225176 nonsense probably null
R6061:Zfp526 UTSW 7 25226332 missense probably damaging 1.00
R6186:Zfp526 UTSW 7 25226136 missense probably benign
R7270:Zfp526 UTSW 7 25225920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGAAAGGCTGAGGCATAAACC -3'
(R):5'- TGCATTCACCACACTGGAAGGG -3'

Sequencing Primer
(F):5'- CCTTTAGCTACAACTTGACTGACAG -3'
(R):5'- AGTGCTAGGCACTAGCTCAG -3'
Posted On2014-01-29