Incidental Mutation 'R1269:Mbtps1'
ID151248
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119520277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 809 (D809G)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect probably damaging
Transcript: ENSMUST00000081381
AA Change: D809G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: D809G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098362
AA Change: D809G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: D809G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212736
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Tspan8 A G 10: 115,849,382 I232V probably damaging Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1580:Mbtps1 UTSW 8 119538900 missense possibly damaging 0.79
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1715:Mbtps1 UTSW 8 119542730 missense probably benign 0.40
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2910:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4611:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6056:Mbtps1 UTSW 8 119515602 missense probably benign
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
R7215:Mbtps1 UTSW 8 119524568 missense possibly damaging 0.82
R7275:Mbtps1 UTSW 8 119542750 missense probably benign
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTGAGCCCCATCCTGGAGAAC -3'
(R):5'- AACGTGAGTGAGTGGTGTAGACCC -3'

Sequencing Primer
(F):5'- GCAGTGAGTTTTACCAGGAACC -3'
(R):5'- GTAGACCCTGTGTGAGATGC -3'
Posted On2014-01-29