Incidental Mutation 'R1269:Tspan8'
ID151251
Institutional Source Beutler Lab
Gene Symbol Tspan8
Ensembl Gene ENSMUSG00000034127
Gene Nametetraspanin 8
SynonymsTm4sf3, E330007O21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1269 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115816832-115849893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115849382 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000136645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035563] [ENSMUST00000080630] [ENSMUST00000179196]
Predicted Effect probably damaging
Transcript: ENSMUST00000035563
AA Change: I232V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049243
Gene: ENSMUSG00000034127
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 4.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080630
AA Change: I232V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079463
Gene: ENSMUSG00000034127
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179196
AA Change: I232V

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136645
Gene: ENSMUSG00000034127
AA Change: I232V

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220081
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik C T 2: 118,761,390 E90K possibly damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Brd8 C T 18: 34,609,804 probably null Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Epc2 T A 2: 49,522,576 S189T probably benign Het
Inpp4a T C 1: 37,389,742 S83P probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mbtps1 T C 8: 119,520,277 D809G probably damaging Het
Nbea T C 3: 56,004,781 E1195G probably benign Het
Nfasc G T 1: 132,610,788 P454T probably damaging Het
Nlrp4e T A 7: 23,353,338 I894N possibly damaging Het
Picalm A T 7: 90,165,549 R129* probably null Het
Plekhg3 T C 12: 76,560,469 I101T probably damaging Het
Pstpip1 A G 9: 56,114,306 D38G probably damaging Het
Sec13 A G 6: 113,737,995 S3P probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sytl1 A T 4: 133,256,115 L370Q probably damaging Het
Tenm2 T A 11: 36,008,358 I2658F possibly damaging Het
Tmc5 A G 7: 118,666,593 M769V probably benign Het
Wbp1 G A 6: 83,119,603 T156I probably benign Het
Wfikkn2 T C 11: 94,238,475 Y280C probably damaging Het
Xrcc6 A T 15: 82,022,847 Q123H possibly damaging Het
Zfp526 T C 7: 25,224,363 S16P probably benign Het
Other mutations in Tspan8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Tspan8 APN 10 115844139 splice site probably benign
IGL01738:Tspan8 APN 10 115817665 splice site probably null
IGL01755:Tspan8 APN 10 115835298 missense probably damaging 1.00
IGL01993:Tspan8 APN 10 115840008 splice site probably benign
IGL02369:Tspan8 APN 10 115839877 missense probably benign 0.01
IGL02369:Tspan8 APN 10 115839878 missense probably benign 0.44
PIT4131001:Tspan8 UTSW 10 115817610 missense probably damaging 1.00
R1693:Tspan8 UTSW 10 115844044 splice site probably benign
R1850:Tspan8 UTSW 10 115833225 missense probably damaging 0.98
R1975:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1976:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1977:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R4058:Tspan8 UTSW 10 115835282 nonsense probably null
R4059:Tspan8 UTSW 10 115835282 nonsense probably null
R4999:Tspan8 UTSW 10 115817629 missense possibly damaging 0.91
R5879:Tspan8 UTSW 10 115833251 missense possibly damaging 0.89
R6290:Tspan8 UTSW 10 115827824 missense probably damaging 0.98
R6358:Tspan8 UTSW 10 115833227 missense probably benign 0.12
R6524:Tspan8 UTSW 10 115844079 missense probably benign
R8139:Tspan8 UTSW 10 115839897 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCATTGAAGATTGGCTGGCAAG -3'
(R):5'- AGATCCCAGATTCACTGCCCTAGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GACTGCCTCAGTGAGATACTTCAA -3'
Posted On2014-01-29