Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Olfr1256'

151263

Institutional Source

Beutler Lab

Gene Symbol

Olfr1256

Ensembl Gene

ENSMUSG00000075073

Gene Name

olfactory receptor 1256

Synonyms

GA_x6K02T2Q125-51276848-51275928, MOR231-1

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89825311-89841555 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89835322 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 208 (V208M)

Ref Sequence

ENSEMBL: ENSMUSP00000149123 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099763] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000215613]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099763
AA Change: V208M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000097351
Gene: ENSMUSG00000075073
AA Change: V208M

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	33	300	1.1e-5	PFAM
Pfam:7tm_1	39	285	5.3e-28	PFAM
Pfam:7tm_4	137	278	7.1e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111520
AA Change: V208M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073
AA Change: V208M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	2.5e-47	PFAM
Pfam:7TM_GPCR_Srsx	33	300	1.1e-5	PFAM
Pfam:7tm_1	39	285	1.3e-16	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213833
AA Change: V208M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215613
AA Change: V208M

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.2267

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Olfr1256

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Olfr1256	APN	2	89835458	nonsense	probably null
IGL01082:Olfr1256	APN	2	89844063	unclassified	probably benign
IGL01613:Olfr1256	APN	2	89835808	missense	probably damaging	0.98
IGL01969:Olfr1256	APN	2	89835720	missense	probably benign	0.01
IGL02625:Olfr1256	APN	2	89835396	missense	probably damaging	1.00
R0843:Olfr1256	UTSW	2	89835616	missense	probably benign	0.01
R1521:Olfr1256	UTSW	2	89835172	nonsense	probably null
R2219:Olfr1256	UTSW	2	89835425	missense	probably damaging	1.00
R2881:Olfr1256	UTSW	2	89844984	splice site	probably null
R3121:Olfr1256	UTSW	2	89835514	missense	probably benign
R3609:Olfr1256	UTSW	2	89835076	missense	probably damaging	0.99
R4984:Olfr1256	UTSW	2	89835813	missense	probably damaging	1.00
R5153:Olfr1256	UTSW	2	89835234	missense	possibly damaging	0.77
R5640:Olfr1256	UTSW	2	89835938	missense	probably benign	0.08
R7198:Olfr1256	UTSW	2	89835732	missense	probably damaging	1.00
R7862:Olfr1256	UTSW	2	89835124	missense	probably benign	0.16
R8100:Olfr1256	UTSW	2	89835685	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAATGGGGAAAGTCTTAGCAGGTCG -3'
(R):5'- CCTCTCAGAGAATCCAAAGGTGCAG -3'

Sequencing Primer
(F):5'- AAGTCTTAGCAGGTCGTGCATAC -3'
(R):5'- GGCCATCTGTAAGCCCTTG -3'

Posted On

2014-01-29