Incidental Mutation 'R1270:E330021D16Rik'
ID151271
Institutional Source Beutler Lab
Gene Symbol E330021D16Rik
Ensembl Gene ENSMUSG00000045291
Gene NameRIKEN cDNA E330021D16 gene
Synonyms
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1270 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136400317-136415569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136401787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 15 (I15N)
Ref Sequence ENSEMBL: ENSMUSP00000144858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058713] [ENSMUST00000203392] [ENSMUST00000204830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058713
AA Change: I15N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060726
Gene: ENSMUSG00000045291
AA Change: I15N

DomainStartEndE-ValueType
Blast:RWD 7 135 7e-63 BLAST
low complexity region 157 168 N/A INTRINSIC
UBCc 204 364 2.33e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203392
AA Change: I15N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144858
Gene: ENSMUSG00000045291
AA Change: I15N

DomainStartEndE-ValueType
Pfam:RWD 1 110 8.9e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204830
AA Change: I15N

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145343
Gene: ENSMUSG00000045291
AA Change: I15N

DomainStartEndE-ValueType
Blast:RWD 7 135 7e-63 BLAST
low complexity region 157 168 N/A INTRINSIC
UBCc 204 364 2.33e-5 SMART
Meta Mutation Damage Score 0.4083 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in E330021D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:E330021D16Rik APN 6 136400998 missense possibly damaging 0.53
IGL01701:E330021D16Rik APN 6 136400806 missense probably damaging 0.99
IGL02194:E330021D16Rik APN 6 136401058 missense probably benign 0.00
IGL03266:E330021D16Rik APN 6 136400923 missense probably damaging 1.00
R1893:E330021D16Rik UTSW 6 136401827 missense possibly damaging 0.92
R4192:E330021D16Rik UTSW 6 136401437 missense probably benign 0.06
R5371:E330021D16Rik UTSW 6 136401373 missense probably benign 0.02
R6418:E330021D16Rik UTSW 6 136401101 missense probably damaging 1.00
R6999:E330021D16Rik UTSW 6 136401274 missense probably benign 0.01
R7035:E330021D16Rik UTSW 6 136401349 missense possibly damaging 0.77
R7316:E330021D16Rik UTSW 6 136401278 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTGAGCTGCTGACTAAGCGAAC -3'
(R):5'- GCCTATTGCCTGGCTAAGAGACAAC -3'

Sequencing Primer
(F):5'- GCTGACTAAGCGAACTGTCTG -3'
(R):5'- CCTCTTGGGAAGATGGATTCTCC -3'
Posted On2014-01-29