Incidental Mutation 'R1270:Ceacam1'
ID151272
Institutional Source Beutler Lab
Gene Symbol Ceacam1
Ensembl Gene ENSMUSG00000074272
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 1
SynonymsCea1, C-CAM, Cc1, Hv2, CD66a, Cea-7, Cea7, Mhv-1, Hv-2, MHVR1, mmCGM1, mCEA1, Bgp1, mmCGM2, Bgp, Cea-1
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1270 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25461707-25477603 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 25466314 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098666] [ENSMUST00000098668] [ENSMUST00000098669] [ENSMUST00000098669] [ENSMUST00000205308] [ENSMUST00000206171] [ENSMUST00000206171] [ENSMUST00000206583] [ENSMUST00000206676] [ENSMUST00000206687] [ENSMUST00000206687]
Predicted Effect probably null
Transcript: ENSMUST00000098666
SMART Domains Protein: ENSMUSP00000096263
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
Pfam:V-set 18 140 1e-21 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098668
SMART Domains Protein: ENSMUSP00000096265
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
Pfam:V-set 12 140 2.4e-21 PFAM
IGc2 157 221 8.37e-15 SMART
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098669
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098669
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205308
Predicted Effect probably null
Transcript: ENSMUST00000206171
Predicted Effect probably null
Transcript: ENSMUST00000206171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect probably benign
Transcript: ENSMUST00000206583
Predicted Effect probably benign
Transcript: ENSMUST00000206676
Predicted Effect probably null
Transcript: ENSMUST00000206687
Predicted Effect probably null
Transcript: ENSMUST00000206687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206717
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice lacking appreciable levels of the two isoforms containing 4 Ig domains and having increased levels of the two isoforms containing 2 Ig domains are viable and fertile. They are significantly more resistant to mouse hepatitis virus than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Ceacam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Ceacam1 APN 7 25471914 missense possibly damaging 0.86
IGL01766:Ceacam1 APN 7 25471995 missense probably damaging 1.00
IGL02094:Ceacam1 APN 7 25474543 missense probably damaging 1.00
IGL02869:Ceacam1 APN 7 25476541 missense probably benign 0.07
IGL03325:Ceacam1 APN 7 25476487 missense possibly damaging 0.83
PIT4445001:Ceacam1 UTSW 7 25476456 missense probably damaging 1.00
PIT4810001:Ceacam1 UTSW 7 25471975 missense probably damaging 1.00
R0464:Ceacam1 UTSW 7 25472017 missense possibly damaging 0.64
R1771:Ceacam1 UTSW 7 25472044 missense probably benign 0.17
R1819:Ceacam1 UTSW 7 25463860 missense possibly damaging 0.68
R1964:Ceacam1 UTSW 7 25474708 missense probably benign 0.13
R2048:Ceacam1 UTSW 7 25476688 missense probably benign 0.09
R2760:Ceacam1 UTSW 7 25477474 missense probably damaging 0.99
R2857:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R2859:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R3546:Ceacam1 UTSW 7 25471914 missense probably benign 0.07
R4471:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.93
R4606:Ceacam1 UTSW 7 25474526 missense probably damaging 0.97
R4810:Ceacam1 UTSW 7 25474520 makesense probably null
R5291:Ceacam1 UTSW 7 25471831 missense probably damaging 0.99
R5405:Ceacam1 UTSW 7 25463865 missense probably benign 0.41
R5423:Ceacam1 UTSW 7 25474526 missense probably benign 0.01
R5851:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.70
R5967:Ceacam1 UTSW 7 25474742 missense probably damaging 0.97
R6216:Ceacam1 UTSW 7 25471996 missense probably benign 0.19
R6235:Ceacam1 UTSW 7 25471792 splice site probably null
R6323:Ceacam1 UTSW 7 25474651 missense probably damaging 1.00
R6545:Ceacam1 UTSW 7 25473854 missense probably damaging 1.00
R7371:Ceacam1 UTSW 7 25474720 missense possibly damaging 0.95
R7760:Ceacam1 UTSW 7 25472025 missense probably damaging 1.00
R7790:Ceacam1 UTSW 7 25473950 missense probably damaging 1.00
R7869:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
R7952:Ceacam1 UTSW 7 25476529 missense probably damaging 0.97
X0028:Ceacam1 UTSW 7 25476420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGACTGGAGGACAGAAGGAC -3'
(R):5'- AGGCATTTGCTAAGGGCCTCAC -3'

Sequencing Primer
(F):5'- GAAGGACATACTTGAATCTGTTCTC -3'
(R):5'- TCATGCTGAAAACTGTCCAGG -3'
Posted On2014-01-29