Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Prx'

151273

Institutional Source

Beutler Lab

Gene Symbol

Prx

Ensembl Gene

ENSMUSG00000053198

Gene Name

periaxin

Synonyms

L-Periaxin

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27499324-27520214 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27518930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 952 (I952N)

Ref Sequence

ENSEMBL: ENSMUSP00000145598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000065487
AA Change: I1091N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198
AA Change: I1091N

Domain	Start	End	E-Value	Type
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	9.05e-5	PROSPERO
internal_repeat_2	317	428	7.28e-6	PROSPERO
internal_repeat_1	321	508	8.09e-9	PROSPERO
internal_repeat_1	503	779	8.09e-9	PROSPERO
internal_repeat_2	840	974	7.28e-6	PROSPERO
internal_repeat_3	1176	1268	9.05e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098644
AA Change: I1091N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198
AA Change: I1091N

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART
low complexity region	179	232	N/A	INTRINSIC
low complexity region	267	289	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
internal_repeat_3	316	419	5.13e-5	PROSPERO
internal_repeat_2	317	428	3.79e-6	PROSPERO
internal_repeat_1	321	508	3.34e-9	PROSPERO
internal_repeat_1	503	779	3.34e-9	PROSPERO
internal_repeat_2	840	974	3.79e-6	PROSPERO
internal_repeat_3	1176	1268	5.13e-5	PROSPERO
low complexity region	1275	1314	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108353

SMART Domains

Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

Domain	Start	End	E-Value	Type
S_TKc	11	347	9.31e-74	SMART
low complexity region	396	410	N/A	INTRINSIC
low complexity region	593	603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108355

SMART Domains

Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
PDZ	28	100	6.83e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125990
AA Change: I952N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.2598

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display locomotor problems as well as difficulty eating and breathing. Demyelination of peripheral nerves develops with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Prx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Prx	APN	7	27519419	missense	probably benign	0.12
IGL01702:Prx	APN	7	27519787	missense	probably benign	0.00
IGL02012:Prx	APN	7	27517901	missense	probably damaging	1.00
IGL02214:Prx	APN	7	27518912	missense	probably damaging	1.00
IGL02498:Prx	APN	7	27518072	missense	probably damaging	1.00
IGL03029:Prx	APN	7	27508061	nonsense	probably null
R0522:Prx	UTSW	7	27518195	missense	probably damaging	0.99
R0655:Prx	UTSW	7	27517421	missense	probably damaging	1.00
R0904:Prx	UTSW	7	27518294	missense	probably damaging	1.00
R1161:Prx	UTSW	7	27519677	missense	probably damaging	1.00
R1170:Prx	UTSW	7	27518007	nonsense	probably null
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1470:Prx	UTSW	7	27517601	missense	probably benign	0.19
R1536:Prx	UTSW	7	27517258	missense	probably damaging	0.99
R1721:Prx	UTSW	7	27517523	missense	probably benign	0.19
R1815:Prx	UTSW	7	27516665	missense	probably damaging	1.00
R1848:Prx	UTSW	7	27518888	missense	possibly damaging	0.70
R1894:Prx	UTSW	7	27519110	missense	possibly damaging	0.68
R2179:Prx	UTSW	7	27517985	missense	probably benign
R2207:Prx	UTSW	7	27516788	missense	probably damaging	1.00
R2312:Prx	UTSW	7	27516626	missense	possibly damaging	0.87
R2356:Prx	UTSW	7	27507859	start gained	probably benign
R2519:Prx	UTSW	7	27518243	missense	probably benign	0.43
R2912:Prx	UTSW	7	27516229	missense	probably damaging	1.00
R4717:Prx	UTSW	7	27516727	missense	probably benign	0.07
R4868:Prx	UTSW	7	27517579	missense	probably benign	0.01
R5153:Prx	UTSW	7	27518476	missense	probably damaging	1.00
R5418:Prx	UTSW	7	27517274	missense	probably damaging	0.99
R5653:Prx	UTSW	7	27517604	missense	probably damaging	1.00
R5895:Prx	UTSW	7	27515284	missense	probably damaging	1.00
R6022:Prx	UTSW	7	27517573	missense	probably damaging	1.00
R6112:Prx	UTSW	7	27516548	missense	probably damaging	1.00
R6223:Prx	UTSW	7	27516836	missense	probably damaging	1.00
R6560:Prx	UTSW	7	27515321	missense	probably damaging	1.00
R6888:Prx	UTSW	7	27519634	missense	possibly damaging	0.73
R7530:Prx	UTSW	7	27507972	missense	probably damaging	1.00
R7854:Prx	UTSW	7	27516641	missense	probably damaging	1.00
R8258:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8259:Prx	UTSW	7	27519383	missense	probably damaging	1.00
R8831:Prx	UTSW	7	27518113	missense	probably damaging	0.99
R9335:Prx	UTSW	7	27518071	missense	probably damaging	1.00
RF009:Prx	UTSW	7	27518960	missense	probably damaging	1.00
X0028:Prx	UTSW	7	27517733	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCATAGCTGGGCAGCTTAAGATCC -3'
(R):5'- AGTTCCACATCGGGCAATGAGAGG -3'

Sequencing Primer
(F):5'- AGCTTAAGATCCCTGCGGTG -3'
(R):5'- CAGTGTGGGCAACTTCAAC -3'

Posted On

2014-01-29