Incidental Mutation 'R1270:Mrgpra9'
ID151275
Institutional Source Beutler Lab
Gene Symbol Mrgpra9
Ensembl Gene ENSMUSG00000074111
Gene NameMAS-related GPR, member A9
SynonymsEG668725, MrgA9
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1270 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47234861-47252848 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 47252783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098436] [ENSMUST00000179005]
Predicted Effect probably null
Transcript: ENSMUST00000098436
SMART Domains Protein: ENSMUSP00000096035
Gene: ENSMUSG00000074111

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:7tm_1 56 225 1.5e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179005
SMART Domains Protein: ENSMUSP00000136396
Gene: ENSMUSG00000074111

DomainStartEndE-ValueType
Pfam:7tm_1 12 178 3.4e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Mrgpra9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mrgpra9 APN 7 47235091 missense possibly damaging 0.85
IGL00575:Mrgpra9 APN 7 47235305 missense possibly damaging 0.76
IGL01649:Mrgpra9 APN 7 47235152 missense probably benign 0.22
IGL03207:Mrgpra9 APN 7 47235637 missense possibly damaging 0.68
R0388:Mrgpra9 UTSW 7 47252794 start codon destroyed probably null 0.08
R0972:Mrgpra9 UTSW 7 47235455 missense probably damaging 0.99
R1381:Mrgpra9 UTSW 7 47235302 missense possibly damaging 0.75
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1448:Mrgpra9 UTSW 7 47235813 missense probably benign 0.02
R2045:Mrgpra9 UTSW 7 47235835 missense probably benign
R2144:Mrgpra9 UTSW 7 47235463 missense probably benign 0.31
R2187:Mrgpra9 UTSW 7 47235049 missense probably damaging 1.00
R2507:Mrgpra9 UTSW 7 47235494 missense possibly damaging 0.63
R2913:Mrgpra9 UTSW 7 47235080 missense probably benign
R3810:Mrgpra9 UTSW 7 47235779 missense probably damaging 0.98
R4177:Mrgpra9 UTSW 7 47235554 missense probably damaging 1.00
R4521:Mrgpra9 UTSW 7 47235190 missense probably damaging 1.00
R4781:Mrgpra9 UTSW 7 47235047 missense possibly damaging 0.88
R4926:Mrgpra9 UTSW 7 47235011 missense possibly damaging 0.62
R6469:Mrgpra9 UTSW 7 47235106 missense probably benign 0.02
R6505:Mrgpra9 UTSW 7 47235136 missense probably benign 0.00
R6724:Mrgpra9 UTSW 7 47235038 missense probably damaging 1.00
R7398:Mrgpra9 UTSW 7 47235637 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAGCTTCTAACCACTCACTGTCCAG -3'
(R):5'- AGGTGGCAGGAAACTCCAATCAAC -3'

Sequencing Primer
(F):5'- GCCTGTCTGCACCAAACTC -3'
(R):5'- CCAGAGATTGAGAACTGTCTCAGG -3'
Posted On2014-01-29