Incidental Mutation 'R1270:Glrx3'
ID 151276
Institutional Source Beutler Lab
Gene Symbol Glrx3
Ensembl Gene ENSMUSG00000031068
Gene Name glutaredoxin 3
Synonyms PKC interacting cousin of thioredoxin, Txnl2, PICOT
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1270 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 137437614-137468594 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137453414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 95 (N95S)
Ref Sequence ENSEMBL: ENSMUSP00000147803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064404] [ENSMUST00000209696] [ENSMUST00000211496] [ENSMUST00000211769]
AlphaFold Q9CQM9
Predicted Effect probably benign
Transcript: ENSMUST00000064404
AA Change: N95S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066621
Gene: ENSMUSG00000031068
AA Change: N95S

DomainStartEndE-ValueType
Pfam:Phosducin 6 102 6.3e-10 PFAM
Pfam:DIM1 13 112 4.5e-9 PFAM
Pfam:Thioredoxin 15 117 1.2e-21 PFAM
Pfam:Glutaredoxin 148 212 2.9e-19 PFAM
Pfam:Glutaredoxin 250 314 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209696
Predicted Effect probably benign
Transcript: ENSMUST00000211496
AA Change: N95S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000211769
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality during late organogenesis and early fetal development. Mice heterozygous for this gene trapped allele exhibit increased response to cardiac injury and decreased cardiac muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Glrx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Glrx3 APN 7 137452713 missense probably damaging 1.00
IGL02435:Glrx3 APN 7 137461396 missense possibly damaging 0.61
F5770:Glrx3 UTSW 7 137459153 missense probably benign
R0347:Glrx3 UTSW 7 137437701 missense unknown
R0359:Glrx3 UTSW 7 137453485 missense possibly damaging 0.80
R3692:Glrx3 UTSW 7 137459117 splice site probably benign
R4909:Glrx3 UTSW 7 137445036 missense probably damaging 1.00
R4920:Glrx3 UTSW 7 137464130 missense probably null 1.00
R5509:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R6831:Glrx3 UTSW 7 137459222 missense possibly damaging 0.76
R7200:Glrx3 UTSW 7 137464436 missense possibly damaging 0.81
R7347:Glrx3 UTSW 7 137459286 missense possibly damaging 0.83
R7356:Glrx3 UTSW 7 137452724 missense probably damaging 0.98
R7481:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R7660:Glrx3 UTSW 7 137459225 missense probably damaging 1.00
R7685:Glrx3 UTSW 7 137459191 missense probably damaging 0.98
R8147:Glrx3 UTSW 7 137463007 missense probably benign 0.00
V7581:Glrx3 UTSW 7 137459153 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACCCACGGGTATTATTACCAC -3'
(R):5'- CATCAGGATCGGCTTCTTACCACAG -3'

Sequencing Primer
(F):5'- GGTCTATTCAAGCTGCGATTAC -3'
(R):5'- ACCACAGCGTGGTTCTTG -3'
Posted On 2014-01-29