Incidental Mutation 'R1270:Enkd1'
ID 151277
Institutional Source Beutler Lab
Gene Symbol Enkd1
Ensembl Gene ENSMUSG00000013155
Gene Name enkurin domain containing 1
Synonyms E130303B06Rik
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1270 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105703651-105708210 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105703901 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 334 (I334T)
Ref Sequence ENSEMBL: ENSMUSP00000013299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013299] [ENSMUST00000013302] [ENSMUST00000042608] [ENSMUST00000093195] [ENSMUST00000098444] [ENSMUST00000211852] [ENSMUST00000211870] [ENSMUST00000211888] [ENSMUST00000212061] [ENSMUST00000212352] [ENSMUST00000212430] [ENSMUST00000212642] [ENSMUST00000212650]
AlphaFold Q7TSV9
Predicted Effect probably damaging
Transcript: ENSMUST00000013299
AA Change: I334T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155
AA Change: I334T

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013302
SMART Domains Protein: ENSMUSP00000013302
Gene: ENSMUSG00000013158

DomainStartEndE-ValueType
Pfam:DUF4691 1 162 3.3e-71 PFAM
low complexity region 200 216 N/A INTRINSIC
low complexity region 252 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042608
SMART Domains Protein: ENSMUSP00000048180
Gene: ENSMUSG00000038000

DomainStartEndE-ValueType
Pfam:TPP1 11 118 2.4e-23 PFAM
low complexity region 259 272 N/A INTRINSIC
low complexity region 296 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093195
SMART Domains Protein: ENSMUSP00000090886
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 15 95 2.81e-15 SMART
PDZ 167 250 1.38e-12 SMART
low complexity region 263 286 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098444
SMART Domains Protein: ENSMUSP00000096043
Gene: ENSMUSG00000005699

DomainStartEndE-ValueType
PB1 4 79 1.28e-9 SMART
PDZ 151 234 1.38e-12 SMART
low complexity region 247 270 N/A INTRINSIC
low complexity region 293 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211852
Predicted Effect probably benign
Transcript: ENSMUST00000211870
Predicted Effect probably benign
Transcript: ENSMUST00000211888
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212162
Predicted Effect probably benign
Transcript: ENSMUST00000212352
Predicted Effect probably benign
Transcript: ENSMUST00000212430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212634
Predicted Effect probably benign
Transcript: ENSMUST00000212642
Predicted Effect probably benign
Transcript: ENSMUST00000212650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212716
Meta Mutation Damage Score 0.3117 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Enkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Enkd1 APN 8 105704342 unclassified probably benign
R1944:Enkd1 UTSW 8 105707576 missense probably damaging 1.00
R3724:Enkd1 UTSW 8 105703925 missense possibly damaging 0.72
R4957:Enkd1 UTSW 8 105704489 missense probably benign 0.06
R7625:Enkd1 UTSW 8 105704633 critical splice donor site probably null
R8388:Enkd1 UTSW 8 105704393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACGCTCCTGTCTTTGAGCTATG -3'
(R):5'- CAGTGTGTCTTAGTGTCTTCAGCCC -3'

Sequencing Primer
(F):5'- TCTTTGAGCTATGACAGGGC -3'
(R):5'- TCACAGCTTGTTGGAACGC -3'
Posted On 2014-01-29