Mutagenetix > Incidental Mutation

Incidental Mutation 'R1270:Aldh1a2'

151281

Institutional Source

Beutler Lab

Gene Symbol

Aldh1a2

Ensembl Gene

ENSMUSG00000013584

Gene Name

aldehyde dehydrogenase family 1, subfamily A2

Synonyms

retinaldehyde dehydrogenase, Aldh1a7, Raldh2

MMRRC Submission

039336-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71215789-71296243 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71281706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 301 (L301V)

Ref Sequence

ENSEMBL: ENSMUSP00000034723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034723]

AlphaFold

Q62148

Predicted Effect

probably benign
Transcript: ENSMUST00000034723
AA Change: L301V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: L301V

Domain	Start	End	E-Value	Type
Pfam:Aldedh	46	509	2.5e-187	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214975

Meta Mutation Damage Score

0.1901

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Aldh1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Aldh1a2	APN	9	71215969	splice site	probably benign
IGL01327:Aldh1a2	APN	9	71285966	missense	possibly damaging	0.95
IGL02293:Aldh1a2	APN	9	71285277	splice site	probably null
IGL03380:Aldh1a2	APN	9	71255117	nonsense	probably null
R0574:Aldh1a2	UTSW	9	71281708	critical splice donor site	probably null
R1189:Aldh1a2	UTSW	9	71263823	missense	possibly damaging	0.69
R1217:Aldh1a2	UTSW	9	71281682	missense	possibly damaging	0.94
R1445:Aldh1a2	UTSW	9	71285210	missense	possibly damaging	0.82
R1717:Aldh1a2	UTSW	9	71293671	missense	probably damaging	0.99
R1737:Aldh1a2	UTSW	9	71285171	missense	possibly damaging	0.56
R1755:Aldh1a2	UTSW	9	71261741	nonsense	probably null
R1984:Aldh1a2	UTSW	9	71253052	missense	probably damaging	1.00
R2248:Aldh1a2	UTSW	9	71215862	missense	possibly damaging	0.90
R2407:Aldh1a2	UTSW	9	71252598	missense	probably damaging	0.99
R3772:Aldh1a2	UTSW	9	71252920	missense	probably damaging	1.00
R4945:Aldh1a2	UTSW	9	71215916	missense	probably benign	0.00
R5042:Aldh1a2	UTSW	9	71285004	missense	possibly damaging	0.69
R5066:Aldh1a2	UTSW	9	71281700	missense	possibly damaging	0.82
R5406:Aldh1a2	UTSW	9	71255121	missense	possibly damaging	0.93
R5425:Aldh1a2	UTSW	9	71253004	missense	probably benign	0.00
R5588:Aldh1a2	UTSW	9	71283450	missense	probably damaging	1.00
R6048:Aldh1a2	UTSW	9	71261767	missense	probably damaging	0.98
R6455:Aldh1a2	UTSW	9	71252914	critical splice acceptor site	probably null
R6642:Aldh1a2	UTSW	9	71252986	missense	probably damaging	1.00
R7253:Aldh1a2	UTSW	9	71215934	missense	probably benign
R7514:Aldh1a2	UTSW	9	71284963	missense	probably damaging	1.00
R7981:Aldh1a2	UTSW	9	71263820	missense	probably damaging	1.00
R8466:Aldh1a2	UTSW	9	71252923	missense	probably benign	0.03
R8943:Aldh1a2	UTSW	9	71261773	missense	probably damaging	1.00
R9001:Aldh1a2	UTSW	9	71285180	missense	probably damaging	1.00
R9700:Aldh1a2	UTSW	9	71215946	nonsense	probably null
RF018:Aldh1a2	UTSW	9	71285270	missense	probably damaging	1.00
Z1177:Aldh1a2	UTSW	9	71283522	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- GCCTTTAGCATCAACTGACTCCCAC -3'
(R):5'- ATGTAGCCAGCACACTGGAAGC -3'

Sequencing Primer
(F):5'- AACTGACTCCCACGTCCTG -3'
(R):5'- GTGGAAATGGCCCTAAACTGTTC -3'

Posted On

2014-01-29