Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Ints2'

151284

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86233085 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 626 (G626R)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: G626R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: G626R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: G626R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: G626R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146421

Meta Mutation Damage Score

0.3327

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTGGACAGGTTGAAATATCCCACAGG -3'
(R):5'- CAGCTATGTGAAACTTCCACTCCACTC -3'

Sequencing Primer
(F):5'- tgcgactacccaggctac -3'
(R):5'- ACTCCACCCTCAGCTCC -3'

Posted On

2014-01-29