Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Abcc3'

151285

Institutional Source

Beutler Lab

Gene Symbol

Abcc3

Ensembl Gene

ENSMUSG00000020865

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 3

Synonyms

MRP3, 1700019L09Rik

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94343295-94392997 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 94357384 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1129 (R1129Q)

Ref Sequence

ENSEMBL: ENSMUSP00000021231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000178136]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021231
AA Change: R1129Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: R1129Q

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
transmembrane domain	64	86	N/A	INTRINSIC
transmembrane domain	101	123	N/A	INTRINSIC
transmembrane domain	130	152	N/A	INTRINSIC
transmembrane domain	172	190	N/A	INTRINSIC
Pfam:ABC_membrane	310	581	4.4e-43	PFAM
AAA	652	827	2.77e-10	SMART
Pfam:ABC_membrane	963	1235	3.2e-46	PFAM
AAA	1310	1495	2.66e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178136
AA Change: R1130Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: R1130Q

Domain	Start	End	E-Value	Type
transmembrane domain	35	57	N/A	INTRINSIC
transmembrane domain	64	86	N/A	INTRINSIC
transmembrane domain	101	123	N/A	INTRINSIC
transmembrane domain	130	152	N/A	INTRINSIC
transmembrane domain	172	190	N/A	INTRINSIC
Pfam:ABC_membrane	310	581	4.8e-34	PFAM
AAA	652	827	2.77e-10	SMART
coiled coil region	854	883	N/A	INTRINSIC
Pfam:ABC_membrane	967	1236	8.6e-48	PFAM
AAA	1311	1496	2.66e-12	SMART

Meta Mutation Damage Score

0.1564

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Abcc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01147:Abcc3	APN	11	94343785	splice site	probably benign
IGL01154:Abcc3	APN	11	94359232	splice site	probably benign
IGL01353:Abcc3	APN	11	94352108	missense	possibly damaging	0.88
IGL02553:Abcc3	APN	11	94351924	missense	probably damaging	1.00
IGL02795:Abcc3	APN	11	94361642	splice site	probably benign
IGL02928:Abcc3	APN	11	94361306	missense	possibly damaging	0.49
IGL02964:Abcc3	APN	11	94351810	missense	possibly damaging	0.93
IGL03006:Abcc3	APN	11	94368595	missense	probably benign	0.18
IGL03345:Abcc3	APN	11	94359337	missense	probably damaging	1.00
R0200:Abcc3	UTSW	11	94355074	missense	probably damaging	0.96
R0377:Abcc3	UTSW	11	94375096	missense	possibly damaging	0.90
R0812:Abcc3	UTSW	11	94375202	splice site	probably benign
R1269:Abcc3	UTSW	11	94357384	missense	probably damaging	1.00
R1375:Abcc3	UTSW	11	94352216	missense	possibly damaging	0.46
R1506:Abcc3	UTSW	11	94357318	missense	possibly damaging	0.89
R1525:Abcc3	UTSW	11	94361236	missense	probably benign	0.00
R1842:Abcc3	UTSW	11	94359612	missense	probably benign	0.00
R1868:Abcc3	UTSW	11	94364063	missense	probably benign	0.06
R2069:Abcc3	UTSW	11	94364417	missense	probably damaging	1.00
R2132:Abcc3	UTSW	11	94367600	missense	probably benign	0.18
R2257:Abcc3	UTSW	11	94363594	missense	probably damaging	1.00
R2395:Abcc3	UTSW	11	94357306	missense	possibly damaging	0.90
R2930:Abcc3	UTSW	11	94361810	missense	probably damaging	0.99
R3081:Abcc3	UTSW	11	94356976	missense	probably damaging	1.00
R3824:Abcc3	UTSW	11	94368620	critical splice acceptor site	probably null
R4385:Abcc3	UTSW	11	94368239	missense	probably damaging	0.99
R4425:Abcc3	UTSW	11	94346044	missense	probably damaging	0.98
R4464:Abcc3	UTSW	11	94358786	missense	probably benign	0.01
R4696:Abcc3	UTSW	11	94350991	missense	probably benign	0.01
R4877:Abcc3	UTSW	11	94367595	missense	probably damaging	0.98
R5172:Abcc3	UTSW	11	94375608	missense	probably damaging	1.00
R5586:Abcc3	UTSW	11	94364421	missense	probably damaging	1.00
R5682:Abcc3	UTSW	11	94392897	missense	probably benign	0.31
R5719:Abcc3	UTSW	11	94351068	missense	probably damaging	1.00
R5816:Abcc3	UTSW	11	94343737	missense	probably damaging	0.99
R5919:Abcc3	UTSW	11	94357306	missense	possibly damaging	0.90
R6222:Abcc3	UTSW	11	94368605	missense	probably benign	0.21
R6264:Abcc3	UTSW	11	94373998	missense	probably damaging	0.99
R6526:Abcc3	UTSW	11	94359372	missense	probably benign	0.21
R6782:Abcc3	UTSW	11	94358950	missense	probably damaging	1.00
R6889:Abcc3	UTSW	11	94375555	missense	possibly damaging	0.49
R6953:Abcc3	UTSW	11	94374835	missense	probably benign	0.03
R7054:Abcc3	UTSW	11	94365225	missense	probably benign	0.01
R7131:Abcc3	UTSW	11	94365031	missense	probably damaging	1.00
R7210:Abcc3	UTSW	11	94373941	missense	probably benign	0.03
R7283:Abcc3	UTSW	11	94357047	missense	probably benign	0.44
R7284:Abcc3	UTSW	11	94357047	missense	probably benign	0.44
R7285:Abcc3	UTSW	11	94357047	missense	probably benign	0.44
R7287:Abcc3	UTSW	11	94357047	missense	probably benign	0.44
R7320:Abcc3	UTSW	11	94367645	missense	probably benign	0.33
R7450:Abcc3	UTSW	11	94361695	missense	probably damaging	1.00
R7469:Abcc3	UTSW	11	94368188	missense	probably damaging	1.00
R7794:Abcc3	UTSW	11	94358871	missense	probably benign	0.12
R7851:Abcc3	UTSW	11	94359660	nonsense	probably null
R7861:Abcc3	UTSW	11	94357249	missense	probably null	1.00
R7934:Abcc3	UTSW	11	94359660	nonsense	probably null
R7944:Abcc3	UTSW	11	94357249	missense	probably null	1.00
R8036:Abcc3	UTSW	11	94345992	missense	possibly damaging	0.47
X0064:Abcc3	UTSW	11	94363498	missense	probably benign	0.00
Z1176:Abcc3	UTSW	11	94361275	missense	probably benign	0.01
Z1177:Abcc3	UTSW	11	94357008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTCAAGCTGTTTCTCCCGATCAC -3'
(R):5'- GTTCTCCAAGAAAGTGTAGGAAGCTCG -3'

Sequencing Primer
(F):5'- CAGCCATCTGTAGGGACCAAG -3'
(R):5'- TCGAGCGAGGCTTGTGG -3'

Posted On

2014-01-29