Mutagenetix > Incidental Mutation

Incidental Mutation 'R1270:D130043K22Rik'

151288

Institutional Source

Beutler Lab

Gene Symbol

D130043K22Rik

Ensembl Gene

ENSMUSG00000006711

Gene Name

RIKEN cDNA D130043K22 gene

Synonyms

MMRRC Submission

039336-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24845135-24901270 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24857338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 248 (S248P)

Ref Sequence

ENSEMBL: ENSMUSP00000116004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]

AlphaFold

Q5SZV5

Predicted Effect

probably benign
Transcript: ENSMUST00000006893
AA Change: S248P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: S248P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	3e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART
FN3	728	808	9.15e1	SMART
PKD	729	820	4.38e-10	SMART
transmembrane domain	965	987	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141572
AA Change: S248P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: S248P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:MANEC	23	102	2e-44	BLAST
low complexity region	236	270	N/A	INTRINSIC
FN3	332	427	3.43e1	SMART
PKD	345	436	3.96e0	SMART
FN3	435	521	3.08e1	SMART
PKD	444	533	7.12e-10	SMART
PKD	539	629	1.46e-6	SMART
PKD	630	723	6.75e-11	SMART
FN3	634	711	5.1e1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in D130043K22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:D130043K22Rik	APN	13	24867174	missense	probably damaging	1.00
IGL01114:D130043K22Rik	APN	13	24857156	missense	probably damaging	0.99
IGL01412:D130043K22Rik	APN	13	24887860	missense	probably damaging	1.00
IGL01542:D130043K22Rik	APN	13	24876037	splice site	probably null
IGL01615:D130043K22Rik	APN	13	24899796	missense	probably damaging	1.00
IGL01705:D130043K22Rik	APN	13	24857941	missense	probably benign	0.00
IGL02220:D130043K22Rik	APN	13	24883755	missense	possibly damaging	0.95
IGL02229:D130043K22Rik	APN	13	24875924	missense	probably damaging	1.00
IGL02576:D130043K22Rik	APN	13	24856870	missense	possibly damaging	0.74
IGL03038:D130043K22Rik	APN	13	24879619	missense	probably damaging	1.00
IGL03117:D130043K22Rik	APN	13	24889842	missense	probably damaging	1.00
IGL03014:D130043K22Rik	UTSW	13	24858092	missense	possibly damaging	0.88
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0019:D130043K22Rik	UTSW	13	24880812	missense	probably damaging	1.00
R0020:D130043K22Rik	UTSW	13	24854492	utr 5 prime	probably benign
R0172:D130043K22Rik	UTSW	13	24872406	missense	probably benign	0.16
R0276:D130043K22Rik	UTSW	13	24858045	missense	possibly damaging	0.92
R0304:D130043K22Rik	UTSW	13	24864815	missense	probably benign	0.07
R0335:D130043K22Rik	UTSW	13	24887877	missense	probably damaging	0.98
R0744:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0833:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R0836:D130043K22Rik	UTSW	13	24863580	splice site	probably benign
R1433:D130043K22Rik	UTSW	13	24871341	missense	probably damaging	1.00
R1682:D130043K22Rik	UTSW	13	24882556	missense	probably damaging	1.00
R1772:D130043K22Rik	UTSW	13	24875999	missense	probably damaging	1.00
R1773:D130043K22Rik	UTSW	13	24882602	missense	possibly damaging	0.80
R1800:D130043K22Rik	UTSW	13	24883894	missense	probably damaging	1.00
R1956:D130043K22Rik	UTSW	13	24885595	missense	probably damaging	1.00
R2255:D130043K22Rik	UTSW	13	24856911	missense	probably damaging	1.00
R2445:D130043K22Rik	UTSW	13	24857036	missense	probably benign	0.04
R2568:D130043K22Rik	UTSW	13	24883891	missense	probably damaging	0.97
R4160:D130043K22Rik	UTSW	13	24862696	missense	probably benign	0.02
R4494:D130043K22Rik	UTSW	13	24871356	missense	probably benign	0.16
R4732:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4733:D130043K22Rik	UTSW	13	24899665	missense	probably damaging	1.00
R4782:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4799:D130043K22Rik	UTSW	13	24878040	missense	probably damaging	1.00
R4864:D130043K22Rik	UTSW	13	24863612	missense	probably damaging	1.00
R5155:D130043K22Rik	UTSW	13	24872290	missense	probably damaging	1.00
R5240:D130043K22Rik	UTSW	13	24877977	missense	probably damaging	1.00
R5383:D130043K22Rik	UTSW	13	24857414	missense	probably benign	0.02
R5493:D130043K22Rik	UTSW	13	24863603	missense	probably damaging	1.00
R6184:D130043K22Rik	UTSW	13	24885591	missense	probably damaging	1.00
R6305:D130043K22Rik	UTSW	13	24885685	missense	probably damaging	1.00
R6436:D130043K22Rik	UTSW	13	24877935	missense	probably damaging	1.00
R6980:D130043K22Rik	UTSW	13	24864781	missense	probably damaging	0.98
R7038:D130043K22Rik	UTSW	13	24893408	missense	probably damaging	1.00
R7085:D130043K22Rik	UTSW	13	24872302	missense	possibly damaging	0.95
R7147:D130043K22Rik	UTSW	13	24882563	missense	probably benign	0.31
R7384:D130043K22Rik	UTSW	13	24882605	missense	probably damaging	1.00
R7398:D130043K22Rik	UTSW	13	24893377	missense	probably damaging	0.97
R7584:D130043K22Rik	UTSW	13	24872370	missense	probably damaging	1.00
R7585:D130043K22Rik	UTSW	13	24885585	missense	probably benign	0.01
R7588:D130043K22Rik	UTSW	13	24887893	missense	probably damaging	0.99
R7610:D130043K22Rik	UTSW	13	24876002	missense	probably benign	0.30
R7903:D130043K22Rik	UTSW	13	24876012	missense	probably damaging	0.98
R7966:D130043K22Rik	UTSW	13	24893423	missense	probably damaging	1.00
R8014:D130043K22Rik	UTSW	13	24856702	missense	probably damaging	1.00
R8374:D130043K22Rik	UTSW	13	24857979	missense	probably benign	0.07
R8543:D130043K22Rik	UTSW	13	24889869	missense	probably benign	0.08
R8775:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8775-TAIL:D130043K22Rik	UTSW	13	24856999	nonsense	probably null
R8806:D130043K22Rik	UTSW	13	24899635	missense	probably benign	0.11
R8916:D130043K22Rik	UTSW	13	24872271	missense	probably benign
R9209:D130043K22Rik	UTSW	13	24857107	missense	possibly damaging	0.96
R9524:D130043K22Rik	UTSW	13	24887893	missense	possibly damaging	0.89
R9743:D130043K22Rik	UTSW	13	24872316	missense	probably damaging	0.97
Z1177:D130043K22Rik	UTSW	13	24856709	missense	probably damaging	1.00
Z1177:D130043K22Rik	UTSW	13	24856834	missense	probably benign	0.39
Z1177:D130043K22Rik	UTSW	13	24872248	missense	possibly damaging	0.79
Z1177:D130043K22Rik	UTSW	13	24880847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAACGAGGGAGGTTTCAATGCTAC -3'
(R):5'- CTGCCTGCTTAGAGAAGGAAGCAC -3'

Sequencing Primer
(F):5'- GGTTTCAATGCTACAGCTACAGG -3'
(R):5'- TGAGGCTCTGACAGACATTC -3'

Posted On

2014-01-29