Mutagenetix > Incidental Mutation

Incidental Mutation 'R1270:Adam7'

151289

Institutional Source

Beutler Lab

Gene Symbol

Adam7

Ensembl Gene

ENSMUSG00000022056

Gene Name

a disintegrin and metallopeptidase domain 7

Synonyms

EAP1

MMRRC Submission

039336-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68497336-68533741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68527669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Methionine at position 93 (K93M)

Ref Sequence

ENSEMBL: ENSMUSP00000022640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022640]

AlphaFold

O35227

Predicted Effect

probably damaging
Transcript: ENSMUST00000022640
AA Change: K93M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: K93M

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	25	156	1.6e-28	PFAM
Pfam:Reprolysin_5	197	378	1.2e-12	PFAM
Pfam:Reprolysin_4	197	382	2.6e-12	PFAM
Pfam:Reprolysin	199	393	1.3e-70	PFAM
Pfam:Reprolysin_2	219	383	1.1e-9	PFAM
Pfam:Reprolysin_3	223	346	9.5e-14	PFAM
DISIN	410	485	8.79e-30	SMART
ACR	486	623	3.51e-58	SMART
transmembrane domain	667	689	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Adam7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00667:Adam7	APN	14	68521938	missense	possibly damaging	0.68
IGL01418:Adam7	APN	14	68525206	missense	probably benign
IGL01934:Adam7	APN	14	68532599	missense	probably damaging	1.00
IGL02655:Adam7	APN	14	68516611	missense	probably damaging	1.00
IGL02669:Adam7	APN	14	68507894	missense	probably damaging	1.00
PIT4445001:Adam7	UTSW	14	68509748	missense	possibly damaging	0.88
R0195:Adam7	UTSW	14	68527627	splice site	probably benign
R0277:Adam7	UTSW	14	68510857	splice site	probably null
R0362:Adam7	UTSW	14	68509656	splice site	probably benign
R0440:Adam7	UTSW	14	68510856	splice site	probably null
R0927:Adam7	UTSW	14	68516684	missense	probably damaging	1.00
R1172:Adam7	UTSW	14	68514921	missense	probably damaging	1.00
R1299:Adam7	UTSW	14	68526299	splice site	probably benign
R1527:Adam7	UTSW	14	68501521	missense	probably benign	0.04
R1543:Adam7	UTSW	14	68521922	splice site	probably benign
R1731:Adam7	UTSW	14	68525356	missense	probably damaging	1.00
R1732:Adam7	UTSW	14	68498450	missense	probably benign	0.00
R1921:Adam7	UTSW	14	68512625	missense	possibly damaging	0.55
R2062:Adam7	UTSW	14	68505161	missense	probably benign	0.09
R2156:Adam7	UTSW	14	68511343	missense	probably benign	0.02
R2353:Adam7	UTSW	14	68505088	missense	probably benign	0.01
R2697:Adam7	UTSW	14	68514783	nonsense	probably null
R4080:Adam7	UTSW	14	68520539	missense	probably benign	0.05
R4775:Adam7	UTSW	14	68507912	missense	probably benign	0.41
R5202:Adam7	UTSW	14	68507856	missense	possibly damaging	0.92
R6006:Adam7	UTSW	14	68511396	missense	probably damaging	1.00
R6087:Adam7	UTSW	14	68510757	missense	probably damaging	1.00
R6376:Adam7	UTSW	14	68505097	missense	possibly damaging	0.78
R6417:Adam7	UTSW	14	68504621	missense	probably benign	0.37
R6672:Adam7	UTSW	14	68504702	critical splice acceptor site	probably null
R6756:Adam7	UTSW	14	68525279	missense	probably benign	0.00
R6777:Adam7	UTSW	14	68525335	missense	probably damaging	1.00
R6913:Adam7	UTSW	14	68533651	missense	probably benign	0.22
R7127:Adam7	UTSW	14	68514769	critical splice donor site	probably null
R7209:Adam7	UTSW	14	68529819	missense	probably damaging	1.00
R7399:Adam7	UTSW	14	68504466	splice site	probably null
R7675:Adam7	UTSW	14	68499853	missense	probably benign	0.07
R7788:Adam7	UTSW	14	68512645	missense	possibly damaging	0.62
R7868:Adam7	UTSW	14	68532641	missense	possibly damaging	0.84
R8135:Adam7	UTSW	14	68516573	missense	probably damaging	1.00
R8281:Adam7	UTSW	14	68507885	missense	possibly damaging	0.65
R8507:Adam7	UTSW	14	68526324	missense	probably damaging	1.00
R9049:Adam7	UTSW	14	68525225	missense	probably benign	0.01
R9240:Adam7	UTSW	14	68509759	missense	probably benign	0.02
R9429:Adam7	UTSW	14	68533631	missense	probably null
R9744:Adam7	UTSW	14	68505134	missense	probably benign	0.00
Z1176:Adam7	UTSW	14	68527701	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GCTCAAAGGGCACTGTTTTCCATTC -3'
(R):5'- tccccacaGCAGTTTTAGTGTGAC -3'

Sequencing Primer
(F):5'- GGGCACTGTTTTCCATTCTACTG -3'
(R):5'- GTGTGACTTACACTTCTTGGAAC -3'

Posted On

2014-01-29