Incidental Mutation 'R1270:Kctd20'
ID 151290
Institutional Source Beutler Lab
Gene Symbol Kctd20
Ensembl Gene ENSMUSG00000005936
Gene Name potassium channel tetramerisation domain containing 20
Synonyms 2410004N11Rik, D17Ertd562e
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R1270 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 28951950-28969549 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28966931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 416 (D416G)
Ref Sequence ENSEMBL: ENSMUSP00000131435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009138] [ENSMUST00000057174] [ENSMUST00000117672] [ENSMUST00000118762] [ENSMUST00000122163] [ENSMUST00000153462] [ENSMUST00000153831] [ENSMUST00000168507]
AlphaFold Q8CDD8
Predicted Effect probably benign
Transcript: ENSMUST00000009138
SMART Domains Protein: ENSMUSP00000009138
Gene: ENSMUSG00000024006

DomainStartEndE-ValueType
Blast:S_TKc 31 77 1e-9 BLAST
S_TKc 89 382 1.69e-94 SMART
S_TK_X 383 447 1.23e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000057174
AA Change: D416G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062282
Gene: ENSMUSG00000005936
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117672
AA Change: D345G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113740
Gene: ENSMUSG00000005936
AA Change: D345G

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118762
AA Change: D345G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112890
Gene: ENSMUSG00000005936
AA Change: D345G

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122163
AA Change: D416G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112957
Gene: ENSMUSG00000005936
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150858
Predicted Effect probably benign
Transcript: ENSMUST00000153462
SMART Domains Protein: ENSMUSP00000120301
Gene: ENSMUSG00000005936

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153831
SMART Domains Protein: ENSMUSP00000122690
Gene: ENSMUSG00000005936

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
BTB 46 151 1.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156732
Predicted Effect possibly damaging
Transcript: ENSMUST00000168507
AA Change: D416G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131435
Gene: ENSMUSG00000005936
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 101 110 N/A INTRINSIC
BTB 117 222 1.77e-7 SMART
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Kctd20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02218:Kctd20 APN 17 28957903 missense probably benign 0.36
IGL02253:Kctd20 APN 17 28961486 missense probably benign 0.12
R0839:Kctd20 UTSW 17 28957898 start codon destroyed possibly damaging 0.79
R1768:Kctd20 UTSW 17 28962850 missense probably damaging 1.00
R1768:Kctd20 UTSW 17 28966781 missense probably damaging 1.00
R4797:Kctd20 UTSW 17 28966792 missense probably damaging 1.00
R5990:Kctd20 UTSW 17 28966910 missense probably benign 0.01
R6642:Kctd20 UTSW 17 28961666 missense probably damaging 0.98
R6799:Kctd20 UTSW 17 28963377 splice site probably null
R6938:Kctd20 UTSW 17 28961581 missense probably benign
R7393:Kctd20 UTSW 17 28963338 missense probably damaging 1.00
R7862:Kctd20 UTSW 17 28962875 missense probably damaging 1.00
R8050:Kctd20 UTSW 17 28952758 critical splice donor site probably null
R8725:Kctd20 UTSW 17 28965051 nonsense probably null
R8727:Kctd20 UTSW 17 28965051 nonsense probably null
R9171:Kctd20 UTSW 17 28966892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTACAATTATGTGCAGCGCCC -3'
(R):5'- GCCGCCTAATTACCAGAGAGCTTC -3'

Sequencing Primer
(F):5'- AGCGCCCTTTTATCCAGATG -3'
(R):5'- GAGAGCTTCTTCACCCAGC -3'
Posted On 2014-01-29