Incidental Mutation 'R1270:Tff2'
ID 151291
Institutional Source Beutler Lab
Gene Symbol Tff2
Ensembl Gene ENSMUSG00000024028
Gene Name trefoil factor 2 (spasmolytic protein 1)
Synonyms SP, mSP
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1270 (G1)
Quality Score 155
Status Validated
Chromosome 17
Chromosomal Location 31141049-31144282 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 31144169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024826] [ENSMUST00000024826] [ENSMUST00000024826] [ENSMUST00000024826]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000024826
SMART Domains Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PD 29 76 1.44e-16 SMART
PD 79 125 6.94e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024826
SMART Domains Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PD 29 76 1.44e-16 SMART
PD 79 125 6.94e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024826
SMART Domains Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PD 29 76 1.44e-16 SMART
PD 79 125 6.94e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024826
SMART Domains Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PD 29 76 1.44e-16 SMART
PD 79 125 6.94e-19 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased gastric proliferation, increased acid secretion, increased susceptibility to gastric ulceration after indomethacin administration, and altered regulation of genes involved in adaptive and immune responses in the pyloric antrum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Tff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Tff2 APN 17 31143266 splice site probably null
IGL01486:Tff2 APN 17 31142342 missense probably benign 0.37
R2054:Tff2 UTSW 17 31143225 missense probably benign 0.02
R2107:Tff2 UTSW 17 31142282 missense possibly damaging 0.50
R6163:Tff2 UTSW 17 31144178 missense probably benign 0.25
R6754:Tff2 UTSW 17 31144233 missense probably benign 0.06
R7187:Tff2 UTSW 17 31142226 missense probably damaging 1.00
R8899:Tff2 UTSW 17 31143139 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGCTGACACCTGTAGACATAG -3'
(R):5'- GGGACAGTTATCAGGGCCATTGAG -3'

Sequencing Primer
(F):5'- GCCCTTCTGAATAAGAGATTCTGG -3'
(R):5'- TTATCAGGGCCATTGAGCAAAC -3'
Posted On 2014-01-29