Incidental Mutation 'R1270:C4a'
ID151292
Institutional Source Beutler Lab
Gene Symbol C4a
Ensembl Gene ENSMUSG00000015451
Gene Namecomplement component 4A (Rodgers blood group)
SynonymsSlp
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R1270 (G1)
Quality Score193
Status Validated
Chromosome17
Chromosomal Location34809092-34823464 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 34814528 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000015595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162133
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in C4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4366:C4a UTSW 17 34814908 unclassified noncoding transcript
R4652:C4a UTSW 17 34810131 exon noncoding transcript
R4681:C4a UTSW 17 34817099 unclassified noncoding transcript
R4818:C4a UTSW 17 34816999 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- AAGAACAGAGCACGGCTTCCTTAC -3'
(R):5'- AGCATTTTCTCCAGCCAAGCCC -3'

Sequencing Primer
(F):5'- ACGGCTTCCTTACCACTCTG -3'
(R):5'- CCCTCCGCTCTAGGCTG -3'
Posted On2014-01-29