Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Cdh2'

151293

Institutional Source

Beutler Lab

Gene Symbol

Cdh2

Ensembl Gene

ENSMUSG00000024304

Gene Name

cadherin 2

Synonyms

Ncad, N-cadherin

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16588877-16809246 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 16627557 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000111516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]

Predicted Effect

probably benign
Transcript: ENSMUST00000025166

SMART Domains

Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
Cadherin_pro	31	123	5.77e-34	SMART
low complexity region	129	141	N/A	INTRINSIC
CA	182	265	3.37e-17	SMART
CA	289	380	2.15e-33	SMART
CA	403	496	4.38e-16	SMART
CA	519	603	2.27e-23	SMART
CA	623	708	5.54e-2	SMART
transmembrane domain	724	746	N/A	INTRINSIC
Pfam:Cadherin_C	753	903	6.3e-54	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115850

SMART Domains

Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304

Domain	Start	End	E-Value	Type
Cadherin_pro	1	66	3.44e-9	SMART
low complexity region	72	84	N/A	INTRINSIC
CA	125	208	3.37e-17	SMART
CA	232	323	2.15e-33	SMART
CA	346	439	4.38e-16	SMART
CA	462	546	2.27e-23	SMART
CA	566	651	5.54e-2	SMART
transmembrane domain	667	689	N/A	INTRINSIC
Pfam:Cadherin_C	690	847	2.5e-57	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kank2	A	T	9: 21,772,760	N724K	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Cdh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Cdh2	APN	18	16627636	missense	possibly damaging	0.69
IGL01560:Cdh2	APN	18	16650438	missense	probably benign	0.01
IGL02028:Cdh2	APN	18	16650420	missense	probably benign	0.07
IGL02227:Cdh2	APN	18	16629586	missense	probably benign	0.01
IGL02229:Cdh2	APN	18	16624753	missense	probably benign
IGL02617:Cdh2	APN	18	16627604	missense	probably damaging	1.00
IGL02685:Cdh2	APN	18	16646500	missense	probably damaging	1.00
IGL02724:Cdh2	APN	18	16629480	missense	probably benign	0.29
R0111:Cdh2	UTSW	18	16774509	missense	probably benign
R0173:Cdh2	UTSW	18	16650257	splice site	probably benign
R0197:Cdh2	UTSW	18	16629576	missense	probably benign
R0563:Cdh2	UTSW	18	16629681	missense	possibly damaging	0.90
R0883:Cdh2	UTSW	18	16629576	missense	probably benign
R1083:Cdh2	UTSW	18	16643959	missense	possibly damaging	0.61
R1469:Cdh2	UTSW	18	16624267	missense	possibly damaging	0.92
R1469:Cdh2	UTSW	18	16624267	missense	possibly damaging	0.92
R1510:Cdh2	UTSW	18	16648594	missense	probably benign
R1875:Cdh2	UTSW	18	16624877	missense	probably benign
R2122:Cdh2	UTSW	18	16774543	missense	probably benign	0.01
R2194:Cdh2	UTSW	18	16640448	missense	probably damaging	1.00
R2254:Cdh2	UTSW	18	16643928	critical splice donor site	probably null
R4471:Cdh2	UTSW	18	16774476	intron	probably null
R4501:Cdh2	UTSW	18	16629585	missense	possibly damaging	0.53
R4620:Cdh2	UTSW	18	16648608	missense	probably benign
R4832:Cdh2	UTSW	18	16627697	missense	probably benign	0.01
R4944:Cdh2	UTSW	18	16650409	missense	probably damaging	0.99
R4958:Cdh2	UTSW	18	16627565	splice site	probably null
R5160:Cdh2	UTSW	18	16629587	missense	probably damaging	0.99
R5190:Cdh2	UTSW	18	16650315	missense	possibly damaging	0.54
R5446:Cdh2	UTSW	18	16646627	missense	probably damaging	1.00
R5552:Cdh2	UTSW	18	16640463	missense	possibly damaging	0.88
R5699:Cdh2	UTSW	18	16646522	nonsense	probably null
R5912:Cdh2	UTSW	18	16640450	missense	possibly damaging	0.79
R5949:Cdh2	UTSW	18	16601630	missense	probably damaging	1.00
R6313:Cdh2	UTSW	18	16774522	missense	probably benign	0.00
R6633:Cdh2	UTSW	18	16640548	missense	probably benign	0.00
R7822:Cdh2	UTSW	18	16624284	missense	probably benign	0.24
R8022:Cdh2	UTSW	18	16590301	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGACACCCATGATCTCAATGGCAG -3'
(R):5'- TGGGATAACTCTCCCTCAGCTCAC -3'

Sequencing Primer
(F):5'- GCAGCCCACTATAGAAGTCATTTG -3'
(R):5'- ATTGTGTCTGACCCCGAAAG -3'

Posted On

2014-01-29