Incidental Mutation 'R1270:Cdh2'
ID151293
Institutional Source Beutler Lab
Gene Symbol Cdh2
Ensembl Gene ENSMUSG00000024304
Gene Namecadherin 2
SynonymsNcad, N-cadherin
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1270 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location16588877-16809246 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 16627557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025166] [ENSMUST00000115850]
Predicted Effect probably benign
Transcript: ENSMUST00000025166
SMART Domains Protein: ENSMUSP00000025166
Gene: ENSMUSG00000024304

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Cadherin_pro 31 123 5.77e-34 SMART
low complexity region 129 141 N/A INTRINSIC
CA 182 265 3.37e-17 SMART
CA 289 380 2.15e-33 SMART
CA 403 496 4.38e-16 SMART
CA 519 603 2.27e-23 SMART
CA 623 708 5.54e-2 SMART
transmembrane domain 724 746 N/A INTRINSIC
Pfam:Cadherin_C 753 903 6.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115850
SMART Domains Protein: ENSMUSP00000111516
Gene: ENSMUSG00000024304

DomainStartEndE-ValueType
Cadherin_pro 1 66 3.44e-9 SMART
low complexity region 72 84 N/A INTRINSIC
CA 125 208 3.37e-17 SMART
CA 232 323 2.15e-33 SMART
CA 346 439 4.38e-16 SMART
CA 462 546 2.27e-23 SMART
CA 566 651 5.54e-2 SMART
transmembrane domain 667 689 N/A INTRINSIC
Pfam:Cadherin_C 690 847 2.5e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Mice lacking the encoded protein exhibit severe developmental defects resulting in embryonic death. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in death by E10. Mutant embryos exhibit several developmental abnormalities such as growth retardation, an enlarged heart, distended pericardial sacs, abnormal heart tube, wavy neural tube, irregular somite shape,and abnormal embryo turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kank2 A T 9: 21,772,760 N724K probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Cdh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Cdh2 APN 18 16627636 missense possibly damaging 0.69
IGL01560:Cdh2 APN 18 16650438 missense probably benign 0.01
IGL02028:Cdh2 APN 18 16650420 missense probably benign 0.07
IGL02227:Cdh2 APN 18 16629586 missense probably benign 0.01
IGL02229:Cdh2 APN 18 16624753 missense probably benign
IGL02617:Cdh2 APN 18 16627604 missense probably damaging 1.00
IGL02685:Cdh2 APN 18 16646500 missense probably damaging 1.00
IGL02724:Cdh2 APN 18 16629480 missense probably benign 0.29
R0111:Cdh2 UTSW 18 16774509 missense probably benign
R0173:Cdh2 UTSW 18 16650257 splice site probably benign
R0197:Cdh2 UTSW 18 16629576 missense probably benign
R0563:Cdh2 UTSW 18 16629681 missense possibly damaging 0.90
R0883:Cdh2 UTSW 18 16629576 missense probably benign
R1083:Cdh2 UTSW 18 16643959 missense possibly damaging 0.61
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1469:Cdh2 UTSW 18 16624267 missense possibly damaging 0.92
R1510:Cdh2 UTSW 18 16648594 missense probably benign
R1875:Cdh2 UTSW 18 16624877 missense probably benign
R2122:Cdh2 UTSW 18 16774543 missense probably benign 0.01
R2194:Cdh2 UTSW 18 16640448 missense probably damaging 1.00
R2254:Cdh2 UTSW 18 16643928 critical splice donor site probably null
R4471:Cdh2 UTSW 18 16774476 intron probably null
R4501:Cdh2 UTSW 18 16629585 missense possibly damaging 0.53
R4620:Cdh2 UTSW 18 16648608 missense probably benign
R4832:Cdh2 UTSW 18 16627697 missense probably benign 0.01
R4944:Cdh2 UTSW 18 16650409 missense probably damaging 0.99
R4958:Cdh2 UTSW 18 16627565 splice site probably null
R5160:Cdh2 UTSW 18 16629587 missense probably damaging 0.99
R5190:Cdh2 UTSW 18 16650315 missense possibly damaging 0.54
R5446:Cdh2 UTSW 18 16646627 missense probably damaging 1.00
R5552:Cdh2 UTSW 18 16640463 missense possibly damaging 0.88
R5699:Cdh2 UTSW 18 16646522 nonsense probably null
R5912:Cdh2 UTSW 18 16640450 missense possibly damaging 0.79
R5949:Cdh2 UTSW 18 16601630 missense probably damaging 1.00
R6313:Cdh2 UTSW 18 16774522 missense probably benign 0.00
R6633:Cdh2 UTSW 18 16640548 missense probably benign 0.00
R7822:Cdh2 UTSW 18 16624284 missense probably benign 0.24
R8022:Cdh2 UTSW 18 16590301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACCCATGATCTCAATGGCAG -3'
(R):5'- TGGGATAACTCTCCCTCAGCTCAC -3'

Sequencing Primer
(F):5'- GCAGCCCACTATAGAAGTCATTTG -3'
(R):5'- ATTGTGTCTGACCCCGAAAG -3'
Posted On2014-01-29