Incidental Mutation 'R1271:Hapln3'
ID 151307
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Name hyaluronan and proteoglycan link protein 3
Synonyms Lpr3, 4930554N11Rik
MMRRC Submission 039337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R1271 (G1)
Quality Score 195
Status Not validated
Chromosome 7
Chromosomal Location 79115102-79131018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79118016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 210 (D210G)
Ref Sequence ENSEMBL: ENSMUSP00000146090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000032835] [ENSMUST00000205782] [ENSMUST00000206092]
AlphaFold Q80WM5
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032835
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205782
AA Change: D210G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206092
AA Change: D210G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206402
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik A T 1: 52,925,334 D78E possibly damaging Het
4930447C04Rik A T 12: 72,892,883 F419I possibly damaging Het
Abca14 T C 7: 120,325,117 V1664A probably damaging Het
Acadvl A G 11: 70,014,700 S71P probably damaging Het
Adcy2 A T 13: 68,642,498 C916S probably damaging Het
Atad2 T C 15: 58,126,589 T164A probably benign Het
Ccdc18 A T 5: 108,202,116 K1045* probably null Het
Cfap43 C T 19: 47,739,744 E1525K probably benign Het
Cfap43 G T 19: 47,747,948 S1368Y probably damaging Het
Csmd3 T A 15: 48,011,059 I610L probably benign Het
Des A T 1: 75,360,646 T77S probably benign Het
Fnip1 T C 11: 54,503,297 V853A probably benign Het
Gabrg1 T A 5: 70,777,144 D292V probably damaging Het
Gcm1 A G 9: 78,059,577 N26S probably benign Het
Gpsm1 G T 2: 26,344,672 R507L probably damaging Het
H2-M1 T A 17: 36,671,245 T155S probably benign Het
Magel2 T C 7: 62,381,014 L1222P unknown Het
Mphosph10 A T 7: 64,390,084 probably null Het
Mup6 A T 4: 60,003,579 probably benign Het
Nsmce1 T A 7: 125,471,254 E128D probably damaging Het
Olfr1206 T A 2: 88,865,131 Y175* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sorbs2 T A 8: 45,795,967 S733T probably damaging Het
Stxbp5 A T 10: 9,816,269 I377K probably damaging Het
Tmem2 T A 19: 21,823,904 I795N possibly damaging Het
Tnfsf4 T A 1: 161,395,703 L41Q probably damaging Het
Usp28 G A 9: 49,035,961 probably null Het
Zcchc6 A C 13: 59,821,855 N75K probably damaging Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 splice site probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 splice site probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
R8894:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8896:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8933:Hapln3 UTSW 7 79117630 unclassified probably benign
R9114:Hapln3 UTSW 7 79121964 missense probably benign 0.00
R9367:Hapln3 UTSW 7 79121707 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTTACTGAGCACCTACCACATGCC -3'
(R):5'- AGCCAGCAGAATCTGTGTTTTGGAC -3'

Sequencing Primer
(F):5'- GCCAGCAGATGCTTTTTAAACC -3'
(R):5'- GTGCAAAGTGCCTGCTTC -3'
Posted On 2014-01-29