Incidental Mutation 'R1271:Nsmce1'
ID151309
Institutional Source Beutler Lab
Gene Symbol Nsmce1
Ensembl Gene ENSMUSG00000030750
Gene NameNSE1 homolog, SMC5-SMC6 complex component
Synonyms
MMRRC Submission 039337-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1271 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location125467640-125491596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125471254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 128 (E128D)
Ref Sequence ENSEMBL: ENSMUSP00000033006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033006]
Predicted Effect probably damaging
Transcript: ENSMUST00000033006
AA Change: E128D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033006
Gene: ENSMUSG00000030750
AA Change: E128D

DomainStartEndE-ValueType
Pfam:SMC_Nse1 29 190 9.2e-26 PFAM
Pfam:zf-RING-like 205 245 7.8e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138616
AA Change: E152D
SMART Domains Protein: ENSMUSP00000118058
Gene: ENSMUSG00000030750
AA Change: E152D

DomainStartEndE-ValueType
Pfam:SMC_Nse1 54 200 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149289
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik A T 1: 52,925,334 D78E possibly damaging Het
4930447C04Rik A T 12: 72,892,883 F419I possibly damaging Het
Abca14 T C 7: 120,325,117 V1664A probably damaging Het
Acadvl A G 11: 70,014,700 S71P probably damaging Het
Adcy2 A T 13: 68,642,498 C916S probably damaging Het
Atad2 T C 15: 58,126,589 T164A probably benign Het
Ccdc18 A T 5: 108,202,116 K1045* probably null Het
Cfap43 C T 19: 47,739,744 E1525K probably benign Het
Cfap43 G T 19: 47,747,948 S1368Y probably damaging Het
Csmd3 T A 15: 48,011,059 I610L probably benign Het
Des A T 1: 75,360,646 T77S probably benign Het
Fnip1 T C 11: 54,503,297 V853A probably benign Het
Gabrg1 T A 5: 70,777,144 D292V probably damaging Het
Gcm1 A G 9: 78,059,577 N26S probably benign Het
Gpsm1 G T 2: 26,344,672 R507L probably damaging Het
H2-M1 T A 17: 36,671,245 T155S probably benign Het
Hapln3 T C 7: 79,118,016 D210G probably damaging Het
Magel2 T C 7: 62,381,014 L1222P unknown Het
Mphosph10 A T 7: 64,390,084 probably null Het
Mup6 A T 4: 60,003,579 probably benign Het
Olfr1206 T A 2: 88,865,131 Y175* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sorbs2 T A 8: 45,795,967 S733T probably damaging Het
Stxbp5 A T 10: 9,816,269 I377K probably damaging Het
Tmem2 T A 19: 21,823,904 I795N possibly damaging Het
Tnfsf4 T A 1: 161,395,703 L41Q probably damaging Het
Usp28 G A 9: 49,035,961 probably null Het
Zcchc6 A C 13: 59,821,855 N75K probably damaging Het
Other mutations in Nsmce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0466:Nsmce1 UTSW 7 125472236 splice site probably benign
R1403:Nsmce1 UTSW 7 125467855 unclassified probably benign
R3039:Nsmce1 UTSW 7 125471156 missense probably damaging 1.00
R3196:Nsmce1 UTSW 7 125486473 missense probably benign 0.12
R3782:Nsmce1 UTSW 7 125486377 missense probably benign 0.00
R6480:Nsmce1 UTSW 7 125491418 missense probably benign
R7047:Nsmce1 UTSW 7 125491434 missense probably benign 0.00
R7139:Nsmce1 UTSW 7 125469082 missense probably benign 0.12
R7503:Nsmce1 UTSW 7 125471934 missense probably benign 0.00
R7684:Nsmce1 UTSW 7 125471176 missense probably damaging 1.00
Z1177:Nsmce1 UTSW 7 125486456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCTCTCAGAGGTCATGGAAAGC -3'
(R):5'- TTTGTAGCAGTGTGCTCAGCCC -3'

Sequencing Primer
(F):5'- CAGAGGTCATGGAAAGCTTACAATAG -3'
(R):5'- ACACCTGGCTAAGACGTTCTG -3'
Posted On2014-01-29