Incidental Mutation 'R1271:4930447C04Rik'
ID151318
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene NameRIKEN cDNA 4930447C04 gene
SynonymsSix6as, Six6os1
MMRRC Submission 039337-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1271 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72881109-72940774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72892883 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 419 (F419I)
Ref Sequence ENSEMBL: ENSMUSP00000106115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044000
AA Change: F418I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098
AA Change: F418I

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110489
AA Change: F419I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098
AA Change: F419I

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132901
Predicted Effect probably benign
Transcript: ENSMUST00000143960
SMART Domains Protein: ENSMUSP00000116391
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 1 70 6.1e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik A T 1: 52,925,334 D78E possibly damaging Het
Abca14 T C 7: 120,325,117 V1664A probably damaging Het
Acadvl A G 11: 70,014,700 S71P probably damaging Het
Adcy2 A T 13: 68,642,498 C916S probably damaging Het
Atad2 T C 15: 58,126,589 T164A probably benign Het
Ccdc18 A T 5: 108,202,116 K1045* probably null Het
Cfap43 C T 19: 47,739,744 E1525K probably benign Het
Cfap43 G T 19: 47,747,948 S1368Y probably damaging Het
Csmd3 T A 15: 48,011,059 I610L probably benign Het
Des A T 1: 75,360,646 T77S probably benign Het
Fnip1 T C 11: 54,503,297 V853A probably benign Het
Gabrg1 T A 5: 70,777,144 D292V probably damaging Het
Gcm1 A G 9: 78,059,577 N26S probably benign Het
Gpsm1 G T 2: 26,344,672 R507L probably damaging Het
H2-M1 T A 17: 36,671,245 T155S probably benign Het
Hapln3 T C 7: 79,118,016 D210G probably damaging Het
Magel2 T C 7: 62,381,014 L1222P unknown Het
Mphosph10 A T 7: 64,390,084 probably null Het
Mup6 A T 4: 60,003,579 probably benign Het
Nsmce1 T A 7: 125,471,254 E128D probably damaging Het
Olfr1206 T A 2: 88,865,131 Y175* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sorbs2 T A 8: 45,795,967 S733T probably damaging Het
Stxbp5 A T 10: 9,816,269 I377K probably damaging Het
Tmem2 T A 19: 21,823,904 I795N possibly damaging Het
Tnfsf4 T A 1: 161,395,703 L41Q probably damaging Het
Usp28 G A 9: 49,035,961 probably null Het
Zcchc6 A C 13: 59,821,855 N75K probably damaging Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1321:4930447C04Rik UTSW 12 72898544 splice site probably benign
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1424:4930447C04Rik UTSW 12 72892895 nonsense probably null
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R5243:4930447C04Rik UTSW 12 72909769 critical splice donor site probably null
R6312:4930447C04Rik UTSW 12 72889767 missense possibly damaging 0.86
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
R7275:4930447C04Rik UTSW 12 72910021 missense possibly damaging 0.71
RF041:4930447C04Rik UTSW 12 72881276 small deletion probably benign
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Z1176:4930447C04Rik UTSW 12 72916726 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCCCAACCATCAGAAAGacaaacaa -3'
(R):5'- acctgtgacacAGATCCAGATTATAGCA -3'

Sequencing Primer
(F):5'- acaaacaagcaaacaaacaaaaaac -3'
(R):5'- ATGGTGCATTCTACCTTATGCAG -3'
Posted On2014-01-29