Incidental Mutation 'R1272:Bzw1'
ID151333
Institutional Source Beutler Lab
Gene Symbol Bzw1
Ensembl Gene ENSMUSG00000051223
Gene Namebasic leucine zipper and W2 domains 1
Synonyms1200015E15Rik
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1272 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58392898-58407353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58397820 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 70 (L70P)
Ref Sequence ENSEMBL: ENSMUSP00000140898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050552] [ENSMUST00000186949] [ENSMUST00000188630] [ENSMUST00000188898]
Predicted Effect probably damaging
Transcript: ENSMUST00000050552
AA Change: L70P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051935
Gene: ENSMUSG00000051223
AA Change: L70P

DomainStartEndE-ValueType
eIF5C 325 410 3.75e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186949
AA Change: L102P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140319
Gene: ENSMUSG00000051223
AA Change: L102P

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
eIF5C 357 442 1.8e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188630
AA Change: L70P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000188898
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Bzw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Bzw1 APN 1 58402942 missense possibly damaging 0.56
IGL00583:Bzw1 APN 1 58401335 splice site probably benign
IGL00816:Bzw1 APN 1 58399054 missense probably damaging 1.00
IGL01625:Bzw1 APN 1 58401440 missense probably benign 0.42
R1138:Bzw1 UTSW 1 58401386 missense probably damaging 1.00
R1229:Bzw1 UTSW 1 58394219 missense probably benign 0.45
R1837:Bzw1 UTSW 1 58400118 missense probably damaging 1.00
R4491:Bzw1 UTSW 1 58404259 missense probably damaging 1.00
R5525:Bzw1 UTSW 1 58402906 missense possibly damaging 0.77
R5641:Bzw1 UTSW 1 58397724 missense probably damaging 0.98
R7794:Bzw1 UTSW 1 58400800 missense probably benign 0.00
X0050:Bzw1 UTSW 1 58401462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGCCATGTAGTTCTTGACCAG -3'
(R):5'- TGGGACAGAGTCCAACCTATCTCAC -3'

Sequencing Primer
(F):5'- CCATGTAGTTCTTGACCAGGTAGG -3'
(R):5'- ACTATCTCCAACCCTTAGCTTACAG -3'
Posted On2014-01-29