Incidental Mutation 'R1272:Mapre3'
ID151339
Institutional Source Beutler Lab
Gene Symbol Mapre3
Ensembl Gene ENSMUSG00000029166
Gene Namemicrotubule-associated protein, RP/EB family, member 3
SynonymsEB3
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R1272 (G1)
Quality Score137
Status Not validated
Chromosome5
Chromosomal Location30814641-30866106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30861888 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 25 (N25K)
Ref Sequence ENSEMBL: ENSMUSP00000144591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031058] [ENSMUST00000200692] [ENSMUST00000202501]
Predicted Effect probably damaging
Transcript: ENSMUST00000031058
AA Change: N25K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031058
Gene: ENSMUSG00000029166
AA Change: N25K

DomainStartEndE-ValueType
Pfam:CH 14 114 4.1e-10 PFAM
low complexity region 201 214 N/A INTRINSIC
Pfam:EB1 219 257 1.4e-17 PFAM
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200692
AA Change: N25K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143890
Gene: ENSMUSG00000029166
AA Change: N25K

DomainStartEndE-ValueType
Pfam:CH 14 114 2.8e-12 PFAM
low complexity region 186 199 N/A INTRINSIC
Pfam:EB1 204 242 1.6e-21 PFAM
low complexity region 251 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202256
Predicted Effect probably damaging
Transcript: ENSMUST00000202501
AA Change: N25K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144591
Gene: ENSMUSG00000029166
AA Change: N25K

DomainStartEndE-ValueType
Pfam:CH 14 114 6.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RP/EB family of genes. The protein localizes to the cytoplasmic microtubule network and binds APCL, a homolog of the adenomatous polyposis coli tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells fail to exhibit F2r agonist-induced vascular hyper-permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Mapre3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Mapre3 APN 5 30864896 missense probably benign 0.15
IGL01391:Mapre3 APN 5 30864897 missense probably damaging 1.00
IGL02650:Mapre3 APN 5 30864709 missense probably damaging 0.97
capen UTSW 5 30864867 missense probably damaging 1.00
R1298:Mapre3 UTSW 5 30864867 missense probably damaging 1.00
R1447:Mapre3 UTSW 5 30861807 splice site probably benign
R1524:Mapre3 UTSW 5 30861917 missense probably damaging 0.99
R2006:Mapre3 UTSW 5 30861824 missense probably damaging 1.00
R2086:Mapre3 UTSW 5 30863202 critical splice acceptor site probably null
R5864:Mapre3 UTSW 5 30863238 missense probably damaging 1.00
R6630:Mapre3 UTSW 5 30862542 missense probably damaging 0.98
R7348:Mapre3 UTSW 5 30861829 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGCCTGTCTCCTGAAGCAGAAAC -3'
(R):5'- CCCTGAATCCAGCTCTAAGCAGTG -3'

Sequencing Primer
(F):5'- CACAGATGCTAGTGAGATCTGTC -3'
(R):5'- GCAGTGTAATATCATGGCTCACC -3'
Posted On2014-01-29