Incidental Mutation 'R1272:Mki67'
ID151341
Institutional Source Beutler Lab
Gene Symbol Mki67
Ensembl Gene ENSMUSG00000031004
Gene Nameantigen identified by monoclonal antibody Ki 67
SynonymsD630048A14Rik, Ki-67, Ki67
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R1272 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location135689784-135716361 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 135700414 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 964 (K964*)
Ref Sequence ENSEMBL: ENSMUSP00000033310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033310]
Predicted Effect probably null
Transcript: ENSMUST00000033310
AA Change: K964*
SMART Domains Protein: ENSMUSP00000033310
Gene: ENSMUSG00000031004
AA Change: K964*

DomainStartEndE-ValueType
FHA 26 76 1.03e-11 SMART
Pfam:PP1_bind 462 519 2.8e-20 PFAM
low complexity region 535 545 N/A INTRINSIC
low complexity region 869 882 N/A INTRINSIC
Pfam:K167R 889 982 1.5e-9 PFAM
K167R 993 1102 2.01e-39 SMART
K167R 1107 1217 1.87e-57 SMART
K167R 1228 1337 1.33e-53 SMART
K167R 1348 1451 6.57e-44 SMART
K167R 1462 1570 9.09e-38 SMART
K167R 1580 1686 5.02e-40 SMART
K167R 1697 1807 9.6e-37 SMART
K167R 1818 1926 5.94e-51 SMART
K167R 1937 2047 1.6e-56 SMART
K167R 2058 2164 4.04e-53 SMART
K167R 2175 2285 1.52e-57 SMART
K167R 2296 2407 1.78e-40 SMART
K167R 2418 2527 1.71e-42 SMART
K167R 2538 2640 7.41e-20 SMART
K167R 2642 2750 1.06e-38 SMART
K167R 2761 2872 2.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211238
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is associated with and may be necessary for cellular proliferation. Alternatively spliced transcript variants have been described. A related pseudogene exists on chromosome X. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice carrying a reporter allele show expression in actively dividing cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Mki67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Mki67 APN 7 135690120 missense probably benign 0.32
IGL00264:Mki67 APN 7 135707820 nonsense probably null
IGL00328:Mki67 APN 7 135696695 missense probably benign 0.03
IGL00570:Mki67 APN 7 135708101 missense possibly damaging 0.88
IGL00584:Mki67 APN 7 135695695 missense probably damaging 1.00
IGL00756:Mki67 APN 7 135698731 missense possibly damaging 0.76
IGL01063:Mki67 APN 7 135694922 missense possibly damaging 0.93
IGL01112:Mki67 APN 7 135714016 missense probably damaging 1.00
IGL01360:Mki67 APN 7 135705776 missense probably damaging 1.00
IGL01457:Mki67 APN 7 135699546 missense probably benign 0.00
IGL01686:Mki67 APN 7 135707813 missense probably benign 0.00
IGL01731:Mki67 APN 7 135696549 missense probably benign 0.03
IGL01775:Mki67 APN 7 135698276 missense possibly damaging 0.71
IGL01806:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01860:Mki67 APN 7 135698957 missense probably damaging 0.98
IGL01938:Mki67 APN 7 135694330 missense probably benign 0.04
IGL02249:Mki67 APN 7 135700522 missense possibly damaging 0.47
IGL02260:Mki67 APN 7 135701968 missense probably benign 0.00
IGL02270:Mki67 APN 7 135698632 missense probably damaging 1.00
IGL02406:Mki67 APN 7 135698793 missense probably benign 0.00
IGL02499:Mki67 APN 7 135694327 missense possibly damaging 0.94
IGL02655:Mki67 APN 7 135714019 missense probably damaging 0.98
IGL02700:Mki67 APN 7 135708202 missense probably benign 0.02
IGL03370:Mki67 APN 7 135695490 missense probably benign 0.00
PIT4468001:Mki67 UTSW 7 135699147 missense probably benign 0.00
R0001:Mki67 UTSW 7 135699172 missense probably damaging 1.00
R0001:Mki67 UTSW 7 135701019 missense probably damaging 0.99
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0043:Mki67 UTSW 7 135700581 missense probably benign 0.16
R0102:Mki67 UTSW 7 135713803 missense probably benign 0.16
R0130:Mki67 UTSW 7 135696459 missense probably damaging 1.00
R0149:Mki67 UTSW 7 135698424 missense probably benign 0.00
R0356:Mki67 UTSW 7 135704406 missense probably benign 0.34
R0482:Mki67 UTSW 7 135699429 missense possibly damaging 0.60
R0508:Mki67 UTSW 7 135700346 missense probably benign
R0532:Mki67 UTSW 7 135698164 nonsense probably null
R0548:Mki67 UTSW 7 135695256 missense probably damaging 1.00
R0548:Mki67 UTSW 7 135696908 missense possibly damaging 0.82
R0557:Mki67 UTSW 7 135699261 missense possibly damaging 0.48
R0627:Mki67 UTSW 7 135708258 missense probably benign 0.31
R0631:Mki67 UTSW 7 135704388 missense probably damaging 0.98
R0848:Mki67 UTSW 7 135701043 missense probably benign 0.21
R1075:Mki67 UTSW 7 135697311 missense probably benign 0.03
R1105:Mki67 UTSW 7 135701050 missense probably benign 0.09
R1331:Mki67 UTSW 7 135698276 missense possibly damaging 0.71
R1486:Mki67 UTSW 7 135699720 missense probably benign 0.00
R1510:Mki67 UTSW 7 135696171 missense probably benign 0.26
R1573:Mki67 UTSW 7 135695116 missense possibly damaging 0.93
R1586:Mki67 UTSW 7 135713972 nonsense probably null
R1599:Mki67 UTSW 7 135699934 missense probably benign 0.34
R1623:Mki67 UTSW 7 135708818 splice site probably null
R1706:Mki67 UTSW 7 135700566 missense probably benign 0.37
R1718:Mki67 UTSW 7 135695494 missense probably damaging 1.00
R1785:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R1816:Mki67 UTSW 7 135707387 missense possibly damaging 0.68
R1862:Mki67 UTSW 7 135699361 missense probably benign 0.09
R1929:Mki67 UTSW 7 135698065 missense possibly damaging 0.46
R1957:Mki67 UTSW 7 135698399 missense probably benign 0.01
R1971:Mki67 UTSW 7 135713959 critical splice donor site probably null
R1998:Mki67 UTSW 7 135705770 missense probably benign 0.00
R2004:Mki67 UTSW 7 135698509 nonsense probably null
R2005:Mki67 UTSW 7 135698509 nonsense probably null
R2006:Mki67 UTSW 7 135698509 nonsense probably null
R2109:Mki67 UTSW 7 135697863 missense probably damaging 1.00
R2130:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2131:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2133:Mki67 UTSW 7 135704241 critical splice acceptor site probably null
R2140:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2141:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2142:Mki67 UTSW 7 135695592 missense possibly damaging 0.94
R2284:Mki67 UTSW 7 135699945 missense probably damaging 0.99
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2869:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2871:Mki67 UTSW 7 135708149 missense probably benign 0.19
R2913:Mki67 UTSW 7 135700686 missense possibly damaging 0.71
R3404:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3405:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3406:Mki67 UTSW 7 135707475 missense probably benign 0.01
R3777:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3778:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3787:Mki67 UTSW 7 135700283 missense possibly damaging 0.93
R3847:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3848:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3853:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3971:Mki67 UTSW 7 135696130 missense probably benign 0.10
R3972:Mki67 UTSW 7 135696130 missense probably benign 0.10
R4258:Mki67 UTSW 7 135695288 missense possibly damaging 0.86
R4343:Mki67 UTSW 7 135695118 missense probably benign 0.10
R4488:Mki67 UTSW 7 135697671 missense probably benign 0.01
R4528:Mki67 UTSW 7 135695359 missense probably damaging 1.00
R4713:Mki67 UTSW 7 135695469 missense probably benign 0.35
R4867:Mki67 UTSW 7 135699856 missense probably damaging 0.97
R4874:Mki67 UTSW 7 135708771 missense probably damaging 0.97
R4897:Mki67 UTSW 7 135696745 missense probably damaging 1.00
R5045:Mki67 UTSW 7 135707904 missense possibly damaging 0.84
R5306:Mki67 UTSW 7 135714001 missense probably damaging 1.00
R5309:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5312:Mki67 UTSW 7 135700830 missense probably damaging 1.00
R5379:Mki67 UTSW 7 135697461 missense possibly damaging 0.95
R5506:Mki67 UTSW 7 135699981 missense possibly damaging 0.60
R5513:Mki67 UTSW 7 135707750 missense probably damaging 0.98
R5742:Mki67 UTSW 7 135704373 missense probably benign 0.20
R5806:Mki67 UTSW 7 135704605 missense probably damaging 1.00
R6008:Mki67 UTSW 7 135697429 missense probably damaging 1.00
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6037:Mki67 UTSW 7 135696803 missense possibly damaging 0.69
R6221:Mki67 UTSW 7 135697914 missense probably benign 0.18
R6294:Mki67 UTSW 7 135704590 missense probably benign 0.09
R6377:Mki67 UTSW 7 135696321 missense possibly damaging 0.67
R6456:Mki67 UTSW 7 135699475 missense possibly damaging 0.59
R6608:Mki67 UTSW 7 135698361 missense probably benign 0.01
R6609:Mki67 UTSW 7 135699829 missense possibly damaging 0.94
R6648:Mki67 UTSW 7 135697440 missense probably damaging 1.00
R6901:Mki67 UTSW 7 135708760 splice site probably null
R6978:Mki67 UTSW 7 135701962 missense probably benign 0.10
R6985:Mki67 UTSW 7 135713865 missense probably damaging 1.00
R7076:Mki67 UTSW 7 135705629 missense probably damaging 0.98
R7217:Mki67 UTSW 7 135704182 missense probably damaging 1.00
R7239:Mki67 UTSW 7 135700176 missense possibly damaging 0.91
R7250:Mki67 UTSW 7 135699324 missense possibly damaging 0.90
R7313:Mki67 UTSW 7 135694671 missense probably benign 0.29
R7336:Mki67 UTSW 7 135713839 missense probably benign 0.03
R7422:Mki67 UTSW 7 135698370 missense probably damaging 1.00
R7451:Mki67 UTSW 7 135699351 missense probably benign 0.01
R7502:Mki67 UTSW 7 135700783 missense possibly damaging 0.53
R7513:Mki67 UTSW 7 135693223 missense probably benign
R7578:Mki67 UTSW 7 135700915 missense possibly damaging 0.68
R7619:Mki67 UTSW 7 135699377 missense probably benign 0.01
R7646:Mki67 UTSW 7 135696769 missense possibly damaging 0.63
R7659:Mki67 UTSW 7 135697426 missense probably damaging 1.00
R7691:Mki67 UTSW 7 135701992 missense not run
X0020:Mki67 UTSW 7 135714001 missense probably damaging 0.96
X0065:Mki67 UTSW 7 135713844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGATTATGCCTGGATTCCCCTG -3'
(R):5'- ACGCTCCTCAAAGATGCAAGGAAAG -3'

Sequencing Primer
(F):5'- ATGTCTACTTTCTTCCCAGATGTG -3'
(R):5'- CTTACTAGGAAGTCAGATGGTCACC -3'
Posted On2014-01-29