Incidental Mutation 'R1272:Ksr1'
ID151350
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1272 (G1)
Quality Score114
Status Not validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 79146078 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 68 (Q68*)
Ref Sequence ENSEMBL: ENSMUSP00000103899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000108264]
Predicted Effect probably null
Transcript: ENSMUST00000018478
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334
AA Change: Q68*

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108264
AA Change: Q68*
SMART Domains Protein: ENSMUSP00000103899
Gene: ENSMUSG00000018334
AA Change: Q68*

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 8.9e-51 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase 563 637 1e-6 PFAM
Pfam:Pkinase_Tyr 563 637 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0590:Ksr1 UTSW 11 79045140 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R2939:Ksr1 UTSW 11 79045181 unclassified probably null
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6346:Ksr1 UTSW 11 79019664 missense possibly damaging 0.93
R6377:Ksr1 UTSW 11 79036494 critical splice donor site probably null
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AAAGTGAGAGCTGGTCGTAGGTCC -3'
(R):5'- GCTGTCGCTTAAAGGCTCCAACAAC -3'

Sequencing Primer
(F):5'- TCGTAGGTCCTCACGCTG -3'
(R):5'- ACTGGGCAGCAGGCTTTC -3'
Posted On2014-01-29