Incidental Mutation 'R1272:Usp54'
ID151352
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1272 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20561110 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1213 (V1213I)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably damaging
Transcript: ENSMUST00000022356
AA Change: V1213I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: V1213I

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035340
AA Change: V1213I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: V1213I

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225721
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 unclassified probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTGGTAGAGAGACTCCAGTTC -3'
(R):5'- GCACTGTCGCTGGGTAAAACAAC -3'

Sequencing Primer
(F):5'- TAGAGAGACTCCAGTTCAGAGG -3'
(R):5'- TGGGTAAAACAACCCCGTTC -3'
Posted On2014-01-29