Incidental Mutation 'R1272:Cd320'
ID151354
Institutional Source Beutler Lab
Gene Symbol Cd320
Ensembl Gene ENSMUSG00000002308
Gene NameCD320 antigen
SynonymsVLDL, NG29, D17Ertd716e, 8D6, 425O18-1
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1272 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33843091-33849774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33848164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000002379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002379] [ENSMUST00000087559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002379
AA Change: V209A

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002379
Gene: ENSMUSG00000002308
AA Change: V209A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LDLa 46 84 1.16e-14 SMART
LDLa 123 161 4.24e-8 SMART
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087559
AA Change: V195A

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084839
Gene: ENSMUSG00000002308
AA Change: V195A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LDLa 32 70 1.16e-14 SMART
LDLa 109 147 4.24e-8 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173418
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the transcobalamin receptor that is expressed at the cell surface. It mediates the cellular uptake of transcobalamin bound cobalamin (vitamin B12), and is involved in B-cell proliferation and immunoglobulin secretion. Mutations in this gene are associated with methylmalonic aciduria. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: The homozygous mutant and heterozygous mice exhibited an increased mean retinal artery-to-vein ratio when compared with controls. Mice homozygous for a gene trap knock-out allele exhibit vitamin B12 deficiency in the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Aldh3b1 A G 19: 3,921,746 L75P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Cd320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Cd320 APN 17 33843240 unclassified probably benign
R0107:Cd320 UTSW 17 33848085 missense probably benign
R0722:Cd320 UTSW 17 33846030 missense possibly damaging 0.65
R1515:Cd320 UTSW 17 33847639 missense probably damaging 1.00
R4062:Cd320 UTSW 17 33847517 missense probably benign 0.08
R4663:Cd320 UTSW 17 33848178 missense probably null 1.00
R4981:Cd320 UTSW 17 33847575 missense probably benign 0.00
R5516:Cd320 UTSW 17 33848047 missense possibly damaging 0.95
R6376:Cd320 UTSW 17 33847517 missense probably benign 0.08
R6536:Cd320 UTSW 17 33847503 missense probably benign 0.00
R6600:Cd320 UTSW 17 33847617 missense probably damaging 1.00
R7417:Cd320 UTSW 17 33847556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGTGTACCAGACTGCTAAGCC -3'
(R):5'- TTCCTTTCTGACAGCAGCAGCGAC -3'

Sequencing Primer
(F):5'- GCCCCTCAGCTACTGATG -3'
(R):5'- GGCAGATAACCCTGACCTCG -3'
Posted On2014-01-29