Incidental Mutation 'R1272:Aldh3b1'
ID151356
Institutional Source Beutler Lab
Gene Symbol Aldh3b1
Ensembl Gene ENSMUSG00000024885
Gene Namealdehyde dehydrogenase 3 family, member B1
Synonyms1700001N19Rik, ALDH7, ALDH4
MMRRC Submission 039338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1272 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3913493-3929761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3921746 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 75 (L75P)
Ref Sequence ENSEMBL: ENSMUSP00000056276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051803]
Predicted Effect probably damaging
Transcript: ENSMUST00000051803
AA Change: L75P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056276
Gene: ENSMUSG00000024885
AA Change: L75P

DomainStartEndE-ValueType
Pfam:Aldedh 2 428 7.4e-88 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,057 L567P probably damaging Het
Ap1m2 A T 9: 21,305,710 V110E possibly damaging Het
Bzw1 T C 1: 58,397,820 L70P probably damaging Het
Cacna1e T C 1: 154,444,968 K1347R probably damaging Het
Cd320 T C 17: 33,848,164 V209A possibly damaging Het
Cmya5 T C 13: 93,095,112 E1156G possibly damaging Het
Dopey1 A G 9: 86,521,424 D1559G probably damaging Het
Kel A T 6: 41,703,470 W19R probably benign Het
Ksr1 G A 11: 79,146,078 Q68* probably null Het
Leo1 G A 9: 75,450,513 D397N possibly damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mapre3 T A 5: 30,861,888 N25K probably damaging Het
Mki67 T A 7: 135,700,414 K964* probably null Het
Nav3 G C 10: 109,736,999 H1600D probably damaging Het
Rdh10 C A 1: 16,108,016 H171N probably damaging Het
Ric8a T C 7: 140,862,376 M513T probably benign Het
Rnf20 A G 4: 49,651,496 E654G probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfcp2l1 C A 1: 118,632,313 P45Q probably damaging Het
Usp54 C T 14: 20,561,110 V1213I probably damaging Het
Zfp616 A T 11: 74,085,236 Q777L probably benign Het
Other mutations in Aldh3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Aldh3b1 APN 19 3918104 missense probably benign 0.03
IGL01402:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01404:Aldh3b1 APN 19 3921205 missense probably benign 0.01
IGL01784:Aldh3b1 APN 19 3921217 missense probably benign 0.32
IGL02608:Aldh3b1 APN 19 3914061 missense probably damaging 1.00
IGL03223:Aldh3b1 APN 19 3915329 missense probably damaging 0.98
R0320:Aldh3b1 UTSW 19 3918999 splice site probably benign
R0472:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R0609:Aldh3b1 UTSW 19 3914024 missense probably damaging 1.00
R1721:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1769:Aldh3b1 UTSW 19 3918740 missense probably damaging 1.00
R1868:Aldh3b1 UTSW 19 3921271 splice site probably benign
R1911:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R1912:Aldh3b1 UTSW 19 3921187 missense probably damaging 0.99
R2067:Aldh3b1 UTSW 19 3921755 missense probably benign 0.01
R2913:Aldh3b1 UTSW 19 3921275 splice site probably benign
R4133:Aldh3b1 UTSW 19 3920808 missense probably damaging 1.00
R5129:Aldh3b1 UTSW 19 3915336 missense probably benign 0.01
R7764:Aldh3b1 UTSW 19 3921563 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCAGGGCACGATGATAAGCACC -3'
(R):5'- CTTGATCTTCTGCTACCAGGGCAC -3'

Sequencing Primer
(F):5'- ACCGAAGGGCTCCTTCC -3'
(R):5'- CCAGGAGTGGGtgaatgaataaatg -3'
Posted On2014-01-29