Incidental Mutation 'R1273:Tmprss11a'
ID151362
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
MMRRC Submission 039339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1273 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86414588 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 299 (R299S)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably benign
Transcript: ENSMUST00000101073
AA Change: R299S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: R299S

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,210 F2579S probably damaging Het
Abca5 T C 11: 110,326,665 K122E probably benign Het
Dnah12 C T 14: 26,739,220 Q934* probably null Het
Fsip2 G A 2: 82,989,408 D5162N possibly damaging Het
Lrp6 A G 6: 134,467,507 probably null Het
Mkx T G 18: 7,002,460 T29P probably benign Het
Nsmce3 A G 7: 64,872,591 Y110H probably benign Het
Olfr901 T C 9: 38,430,684 V134A probably benign Het
Saal1 A T 7: 46,692,942 V359E probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1704:Tmprss11a UTSW 5 86428702 missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86428652 missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86411809 nonsense probably null
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86411815 missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86420020 missense probably damaging 1.00
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAATGTCAGCGTGTCTGTTTCCC -3'
(R):5'- AGGTTTTCCAGAAAACAATTGGCAATCC -3'

Sequencing Primer
(F):5'- CCTGCAGGCATCGTAATTTC -3'
(R):5'- ggtctcactgtgtaatcctgtc -3'
Posted On2014-01-29