Incidental Mutation 'R1254:Abcb10'
ID151388
Institutional Source Beutler Lab
Gene Symbol Abcb10
Ensembl Gene ENSMUSG00000031974
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 10
SynonymsABC-me
MMRRC Submission 039321-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1254 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123952459-123983122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 123962052 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 495 (G495D)
Ref Sequence ENSEMBL: ENSMUSP00000075011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000075578
AA Change: G495D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: G495D

DomainStartEndE-ValueType
Pfam:ABC_membrane 136 407 1.7e-60 PFAM
AAA 484 675 1.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212356
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Coro2b A G 9: 62,428,965 L280P probably damaging Het
D430041D05Rik T G 2: 104,201,303 K1649N probably damaging Het
Duox2 T A 2: 122,283,478 H1191L probably damaging Het
Etl4 A G 2: 20,807,923 T1430A probably damaging Het
Hivep3 A G 4: 120,099,293 Y1602C probably damaging Het
Ints6 A G 14: 62,716,374 S180P probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Klhdc3 C T 17: 46,678,067 V66I probably benign Het
Olfr477 T A 7: 107,990,440 V25D probably benign Het
Pank1 T C 19: 34,840,860 H93R probably benign Het
Pcdhb16 T G 18: 37,479,295 V436G possibly damaging Het
Plekha6 G A 1: 133,272,589 R302H probably benign Het
Ptk2 C T 15: 73,229,970 R797Q probably benign Het
Rnase10 A T 14: 51,009,626 M117L probably damaging Het
Rnf151 A T 17: 24,717,552 C20* probably null Het
Robo4 T C 9: 37,410,840 probably null Het
Rps6ka5 G T 12: 100,619,529 H168Q probably damaging Het
Sstr1 G A 12: 58,213,322 V244M possibly damaging Het
Tmem147 A T 7: 30,729,370 Y17* probably null Het
Vmn1r7 A G 6: 57,024,787 C163R probably damaging Het
Other mutations in Abcb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Abcb10 APN 8 123954427 missense probably benign 0.00
IGL02279:Abcb10 APN 8 123954361 missense probably benign 0.17
IGL02302:Abcb10 APN 8 123958672 missense possibly damaging 0.89
IGL02342:Abcb10 APN 8 123962034 missense probably damaging 1.00
IGL03062:Abcb10 APN 8 123954315 missense possibly damaging 0.49
IGL03409:Abcb10 APN 8 123965023 missense possibly damaging 0.63
R0320:Abcb10 UTSW 8 123963007 missense probably benign 0.00
R0436:Abcb10 UTSW 8 123971001 missense probably benign 0.01
R1074:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1224:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1225:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1226:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1251:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1252:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1255:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1256:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1355:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1370:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1424:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1499:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1769:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R2096:Abcb10 UTSW 8 123982456 missense probably benign 0.01
R2125:Abcb10 UTSW 8 123965092 missense probably benign 0.29
R2274:Abcb10 UTSW 8 123982752 missense probably benign 0.23
R4801:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4802:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4850:Abcb10 UTSW 8 123982690 missense probably benign 0.01
R5320:Abcb10 UTSW 8 123971024 missense probably benign 0.11
R5947:Abcb10 UTSW 8 123967998 splice site probably null
R6006:Abcb10 UTSW 8 123968065 missense probably benign 0.00
R6328:Abcb10 UTSW 8 123962017 missense probably damaging 1.00
R7168:Abcb10 UTSW 8 123966611 missense
V7581:Abcb10 UTSW 8 123969761 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCACATGTCAGCAGAGTTCCAG -3'
(R):5'- ACTTCAGTCAGGCAAGGGAGACAC -3'

Sequencing Primer
(F):5'- CTGACCCATTTCCAAGGGTAG -3'
(R):5'- GGCATTCTGCCCTGAGC -3'
Posted On2014-01-29