Mutagenetix > Incidental Mutation

Incidental Mutation 'R1254:Robo4'

151389

Institutional Source

Beutler Lab

Gene Symbol

Robo4

Ensembl Gene

ENSMUSG00000032125

Gene Name

roundabout guidance receptor 4

Synonyms

Magic roundabout, 1200012D01Rik

MMRRC Submission

039321-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R1254 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37313198-37325319 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 37322136 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000150722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]

AlphaFold

Q8C310

Predicted Effect

probably null
Transcript: ENSMUST00000102895

SMART Domains

Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	720	733	N/A	INTRINSIC
low complexity region	748	762	N/A	INTRINSIC
low complexity region	775	799	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	871	880	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115046

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115046

SMART Domains

Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	484	500	N/A	INTRINSIC
low complexity region	540	546	N/A	INTRINSIC
low complexity region	596	614	N/A	INTRINSIC
low complexity region	747	756	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	807	821	N/A	INTRINSIC
low complexity region	834	858	N/A	INTRINSIC
low complexity region	914	925	N/A	INTRINSIC
low complexity region	930	939	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115048

SMART Domains

Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
IG	48	144	2.51e0	SMART
IGc2	160	225	6.86e-11	SMART
FN3	263	343	2.05e0	SMART
FN3	358	440	1.27e-3	SMART
low complexity region	488	494	N/A	INTRINSIC
low complexity region	544	562	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
low complexity region	727	740	N/A	INTRINSIC
low complexity region	755	769	N/A	INTRINSIC
low complexity region	782	806	N/A	INTRINSIC
low complexity region	862	873	N/A	INTRINSIC
low complexity region	878	887	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167089

Predicted Effect

probably null
Transcript: ENSMUST00000214185

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215777

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 124,688,791 (GRCm39)	G495D	probably damaging	Het
Ccdc39	T	C	3: 33,880,629 (GRCm39)	K446R	probably damaging	Het
Coro2b	A	G	9: 62,336,247 (GRCm39)	L280P	probably damaging	Het
D430041D05Rik	T	G	2: 104,031,648 (GRCm39)	K1649N	probably damaging	Het
Duox2	T	A	2: 122,113,959 (GRCm39)	H1191L	probably damaging	Het
Etl4	A	G	2: 20,812,734 (GRCm39)	T1430A	probably damaging	Het
Hivep3	A	G	4: 119,956,490 (GRCm39)	Y1602C	probably damaging	Het
Ints6	A	G	14: 62,953,823 (GRCm39)	S180P	probably benign	Het
Jarid2	T	A	13: 45,059,752 (GRCm39)	N661K	probably damaging	Het
Klhdc3	C	T	17: 46,988,993 (GRCm39)	V66I	probably benign	Het
Or5p56	T	A	7: 107,589,647 (GRCm39)	V25D	probably benign	Het
Pank1	T	C	19: 34,818,260 (GRCm39)	H93R	probably benign	Het
Pcdhb16	T	G	18: 37,612,348 (GRCm39)	V436G	possibly damaging	Het
Plekha6	G	A	1: 133,200,327 (GRCm39)	R302H	probably benign	Het
Ptk2	C	T	15: 73,101,819 (GRCm39)	R797Q	probably benign	Het
Rnase10	A	T	14: 51,247,083 (GRCm39)	M117L	probably damaging	Het
Rnf151	A	T	17: 24,936,526 (GRCm39)	C20*	probably null	Het
Rps6ka5	G	T	12: 100,585,788 (GRCm39)	H168Q	probably damaging	Het
Sstr1	G	A	12: 58,260,108 (GRCm39)	V244M	possibly damaging	Het
Tmem147	A	T	7: 30,428,795 (GRCm39)	Y17*	probably null	Het
Vmn1r7	A	G	6: 57,001,772 (GRCm39)	C163R	probably damaging	Het

Other mutations in Robo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Robo4	APN	9	37,322,400 (GRCm39)	missense	probably damaging	1.00
IGL00392:Robo4	APN	9	37,319,525 (GRCm39)	missense	probably damaging	1.00
IGL00491:Robo4	APN	9	37,317,231 (GRCm39)	missense	possibly damaging	0.52
IGL00792:Robo4	APN	9	37,319,507 (GRCm39)	missense	probably damaging	1.00
IGL01062:Robo4	APN	9	37,317,296 (GRCm39)	missense	probably benign	0.08
IGL01287:Robo4	APN	9	37,324,336 (GRCm39)	missense	possibly damaging	0.96
IGL02289:Robo4	APN	9	37,319,496 (GRCm39)	missense	probably damaging	1.00
IGL02486:Robo4	APN	9	37,319,670 (GRCm39)	missense	probably damaging	1.00
IGL02851:Robo4	APN	9	37,324,678 (GRCm39)	missense	probably damaging	0.96
IGL02898:Robo4	APN	9	37,319,472 (GRCm39)	missense	probably damaging	0.99
IGL02965:Robo4	APN	9	37,321,765 (GRCm39)	missense	possibly damaging	0.82
IGL03071:Robo4	APN	9	37,315,580 (GRCm39)	splice site	probably benign
IGL03102:Robo4	APN	9	37,315,481 (GRCm39)	missense	probably damaging	1.00
H8562:Robo4	UTSW	9	37,317,106 (GRCm39)	intron	probably benign
PIT4305001:Robo4	UTSW	9	37,322,687 (GRCm39)	missense	probably damaging	1.00
R0056:Robo4	UTSW	9	37,315,773 (GRCm39)	missense	probably benign	0.03
R0068:Robo4	UTSW	9	37,315,773 (GRCm39)	missense	probably benign	0.03
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0233:Robo4	UTSW	9	37,313,977 (GRCm39)	missense	probably damaging	1.00
R0416:Robo4	UTSW	9	37,316,062 (GRCm39)	splice site	probably benign
R1005:Robo4	UTSW	9	37,319,547 (GRCm39)	missense	probably damaging	1.00
R1174:Robo4	UTSW	9	37,324,348 (GRCm39)	missense	probably damaging	1.00
R1183:Robo4	UTSW	9	37,319,348 (GRCm39)	missense	probably damaging	1.00
R1398:Robo4	UTSW	9	37,319,372 (GRCm39)	critical splice donor site	probably null
R1505:Robo4	UTSW	9	37,314,523 (GRCm39)	missense	probably damaging	0.98
R1701:Robo4	UTSW	9	37,314,739 (GRCm39)	missense	probably benign	0.44
R1834:Robo4	UTSW	9	37,324,355 (GRCm39)	missense	probably benign	0.09
R1899:Robo4	UTSW	9	37,315,366 (GRCm39)	splice site	probably benign
R2203:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2204:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2351:Robo4	UTSW	9	37,322,956 (GRCm39)	missense	probably benign	0.01
R2448:Robo4	UTSW	9	37,313,958 (GRCm39)	missense	possibly damaging	0.96
R2847:Robo4	UTSW	9	37,315,772 (GRCm39)	nonsense	probably null
R2851:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2852:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R2877:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3123:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3124:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3125:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3805:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3806:Robo4	UTSW	9	37,315,734 (GRCm39)	missense	possibly damaging	0.73
R3892:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R3905:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R3938:Robo4	UTSW	9	37,313,313 (GRCm39)	start gained	probably benign
R4261:Robo4	UTSW	9	37,316,877 (GRCm39)	missense	probably benign	0.04
R4434:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4435:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4561:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4562:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R4568:Robo4	UTSW	9	37,316,118 (GRCm39)	missense	possibly damaging	0.59
R4695:Robo4	UTSW	9	37,314,495 (GRCm39)	missense	probably damaging	1.00
R4921:Robo4	UTSW	9	37,313,856 (GRCm39)	missense	probably benign
R5000:Robo4	UTSW	9	37,319,664 (GRCm39)	missense	probably benign	0.02
R5056:Robo4	UTSW	9	37,316,102 (GRCm39)	missense	probably benign	0.00
R5125:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5178:Robo4	UTSW	9	37,319,256 (GRCm39)	missense	probably damaging	1.00
R5278:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5279:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5285:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5347:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5348:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5361:Robo4	UTSW	9	37,324,674 (GRCm39)	missense	probably benign	0.01
R5403:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5404:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5488:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5489:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5490:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5494:Robo4	UTSW	9	37,322,786 (GRCm39)	frame shift	probably null
R5629:Robo4	UTSW	9	37,319,658 (GRCm39)	missense	probably damaging	1.00
R5736:Robo4	UTSW	9	37,316,093 (GRCm39)	missense	possibly damaging	0.63
R5796:Robo4	UTSW	9	37,322,970 (GRCm39)	missense	probably benign	0.00
R5987:Robo4	UTSW	9	37,322,696 (GRCm39)	missense	probably damaging	1.00
R6178:Robo4	UTSW	9	37,316,926 (GRCm39)	nonsense	probably null
R6189:Robo4	UTSW	9	37,314,829 (GRCm39)	missense	probably benign	0.35
R6365:Robo4	UTSW	9	37,322,008 (GRCm39)	missense	probably benign	0.34
R6528:Robo4	UTSW	9	37,315,664 (GRCm39)	missense	possibly damaging	0.92
R6887:Robo4	UTSW	9	37,313,363 (GRCm39)	missense	possibly damaging	0.82
R7196:Robo4	UTSW	9	37,314,001 (GRCm39)	missense	possibly damaging	0.92
R7408:Robo4	UTSW	9	37,322,277 (GRCm39)	missense	probably benign	0.09
R7419:Robo4	UTSW	9	37,314,105 (GRCm39)	missense	probably benign	0.18
R7486:Robo4	UTSW	9	37,316,870 (GRCm39)	missense	probably damaging	0.99
R7707:Robo4	UTSW	9	37,324,418 (GRCm39)	missense	probably damaging	1.00
R7839:Robo4	UTSW	9	37,322,055 (GRCm39)	missense	probably damaging	1.00
R8079:Robo4	UTSW	9	37,313,931 (GRCm39)	missense	possibly damaging	0.82
R8081:Robo4	UTSW	9	37,316,936 (GRCm39)	missense	probably damaging	0.99
R8280:Robo4	UTSW	9	37,315,372 (GRCm39)	missense	probably benign	0.00
R8526:Robo4	UTSW	9	37,314,801 (GRCm39)	nonsense	probably null
R8547:Robo4	UTSW	9	37,315,674 (GRCm39)	missense	possibly damaging	0.69
R8735:Robo4	UTSW	9	37,319,577 (GRCm39)	missense	possibly damaging	0.92
R8836:Robo4	UTSW	9	37,317,130 (GRCm39)	missense	unknown
R8889:Robo4	UTSW	9	37,314,601 (GRCm39)	missense	probably benign	0.00
R9018:Robo4	UTSW	9	37,315,520 (GRCm39)	missense	probably benign	0.00
R9182:Robo4	UTSW	9	37,313,206 (GRCm39)	start gained	probably benign
R9375:Robo4	UTSW	9	37,316,158 (GRCm39)	missense	probably damaging	1.00
R9621:Robo4	UTSW	9	37,317,509 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTTTCAGGTCCACCAGTCCAG -3'
(R):5'- TCCTCCTCTAAGGATGACAGCGAG -3'

Sequencing Primer
(F):5'- CAGGTTGGAATCCGTACTGC -3'
(R):5'- GGAGCTGGACAGGTTGC -3'

Posted On

2014-01-29