Incidental Mutation 'R1254:Rnase10'
ID151395
Institutional Source Beutler Lab
Gene Symbol Rnase10
Ensembl Gene ENSMUSG00000021872
Gene Nameribonuclease, RNase A family, 10 (non-active)
Synonyms4930474F22Rik
MMRRC Submission 039321-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1254 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51007751-51010758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51009626 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 117 (M117L)
Ref Sequence ENSEMBL: ENSMUSP00000131065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022424] [ENSMUST00000164632]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022424
AA Change: M154L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022424
Gene: ENSMUSG00000021872
AA Change: M154L

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
Pfam:RnaseA 132 244 2.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164632
AA Change: M117L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131065
Gene: ENSMUSG00000021872
AA Change: M117L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:RnaseA 91 208 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to decreased bone mineral density, alterations in B cell, T cell and NK cell number, and abnormal circulating glucose, creatinine, chloride and serum albumin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Coro2b A G 9: 62,428,965 L280P probably damaging Het
D430041D05Rik T G 2: 104,201,303 K1649N probably damaging Het
Duox2 T A 2: 122,283,478 H1191L probably damaging Het
Etl4 A G 2: 20,807,923 T1430A probably damaging Het
Hivep3 A G 4: 120,099,293 Y1602C probably damaging Het
Ints6 A G 14: 62,716,374 S180P probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Klhdc3 C T 17: 46,678,067 V66I probably benign Het
Olfr477 T A 7: 107,990,440 V25D probably benign Het
Pank1 T C 19: 34,840,860 H93R probably benign Het
Pcdhb16 T G 18: 37,479,295 V436G possibly damaging Het
Plekha6 G A 1: 133,272,589 R302H probably benign Het
Ptk2 C T 15: 73,229,970 R797Q probably benign Het
Rnf151 A T 17: 24,717,552 C20* probably null Het
Robo4 T C 9: 37,410,840 probably null Het
Rps6ka5 G T 12: 100,619,529 H168Q probably damaging Het
Sstr1 G A 12: 58,213,322 V244M possibly damaging Het
Tmem147 A T 7: 30,729,370 Y17* probably null Het
Vmn1r7 A G 6: 57,024,787 C163R probably damaging Het
Other mutations in Rnase10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rnase10 APN 14 51009781 missense possibly damaging 0.91
IGL01534:Rnase10 APN 14 51007979 missense probably benign 0.00
IGL02082:Rnase10 APN 14 51009399 missense probably damaging 1.00
IGL02661:Rnase10 APN 14 51009816 missense probably damaging 1.00
R1989:Rnase10 UTSW 14 51009638 missense probably benign 0.03
R3878:Rnase10 UTSW 14 51009432 missense probably damaging 0.97
R5405:Rnase10 UTSW 14 51009860 missense probably damaging 1.00
R5942:Rnase10 UTSW 14 51009278 missense probably benign 0.08
R6107:Rnase10 UTSW 14 51009294 missense possibly damaging 0.89
R6994:Rnase10 UTSW 14 51009681 missense probably damaging 1.00
R7138:Rnase10 UTSW 14 51009710 missense probably damaging 1.00
R7186:Rnase10 UTSW 14 51009785 missense probably damaging 1.00
R7848:Rnase10 UTSW 14 51009513 missense possibly damaging 0.75
R7931:Rnase10 UTSW 14 51009513 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GGCTACAAAGAAATGGCACAACCTG -3'
(R):5'- TGCAAGTTGAATGACACCTCCCC -3'

Sequencing Primer
(F):5'- AATGGCACAACCTGTCTGG -3'
(R):5'- GCACAAGGTGCTTCATTTAGTC -3'
Posted On2014-01-29