Incidental Mutation 'R1254:Ints6'
ID 151396
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Name integrator complex subunit 6
Synonyms Notch2l, DICE1, Ddx26, 2900075H24Rik
MMRRC Submission 039321-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1254 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 62913779-62998618 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62953823 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 180 (S180P)
Ref Sequence ENSEMBL: ENSMUSP00000152954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000223585]
AlphaFold Q6PCM2
Predicted Effect probably benign
Transcript: ENSMUST00000053959
AA Change: S180P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: S180P

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223585
AA Change: S180P

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225406
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Coro2b A G 9: 62,336,247 (GRCm39) L280P probably damaging Het
D430041D05Rik T G 2: 104,031,648 (GRCm39) K1649N probably damaging Het
Duox2 T A 2: 122,113,959 (GRCm39) H1191L probably damaging Het
Etl4 A G 2: 20,812,734 (GRCm39) T1430A probably damaging Het
Hivep3 A G 4: 119,956,490 (GRCm39) Y1602C probably damaging Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Klhdc3 C T 17: 46,988,993 (GRCm39) V66I probably benign Het
Or5p56 T A 7: 107,589,647 (GRCm39) V25D probably benign Het
Pank1 T C 19: 34,818,260 (GRCm39) H93R probably benign Het
Pcdhb16 T G 18: 37,612,348 (GRCm39) V436G possibly damaging Het
Plekha6 G A 1: 133,200,327 (GRCm39) R302H probably benign Het
Ptk2 C T 15: 73,101,819 (GRCm39) R797Q probably benign Het
Rnase10 A T 14: 51,247,083 (GRCm39) M117L probably damaging Het
Rnf151 A T 17: 24,936,526 (GRCm39) C20* probably null Het
Robo4 T C 9: 37,322,136 (GRCm39) probably null Het
Rps6ka5 G T 12: 100,585,788 (GRCm39) H168Q probably damaging Het
Sstr1 G A 12: 58,260,108 (GRCm39) V244M possibly damaging Het
Tmem147 A T 7: 30,428,795 (GRCm39) Y17* probably null Het
Vmn1r7 A G 6: 57,001,772 (GRCm39) C163R probably damaging Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62,940,628 (GRCm39) missense probably damaging 1.00
IGL00763:Ints6 APN 14 62,938,314 (GRCm39) splice site probably benign
IGL01624:Ints6 APN 14 62,934,320 (GRCm39) missense probably benign 0.07
IGL01721:Ints6 APN 14 62,951,188 (GRCm39) missense probably damaging 0.96
IGL02146:Ints6 APN 14 62,996,709 (GRCm39) missense possibly damaging 0.91
G1Funyon:Ints6 UTSW 14 62,939,902 (GRCm39) missense probably benign
R0302:Ints6 UTSW 14 62,946,961 (GRCm39) missense probably damaging 1.00
R0320:Ints6 UTSW 14 62,945,084 (GRCm39) nonsense probably null
R0543:Ints6 UTSW 14 62,934,060 (GRCm39) missense probably damaging 1.00
R0554:Ints6 UTSW 14 62,942,200 (GRCm39) missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62,934,208 (GRCm39) missense probably benign
R0960:Ints6 UTSW 14 62,947,015 (GRCm39) missense probably benign 0.39
R1216:Ints6 UTSW 14 62,945,147 (GRCm39) missense probably damaging 1.00
R1296:Ints6 UTSW 14 62,942,352 (GRCm39) splice site probably benign
R1548:Ints6 UTSW 14 62,951,141 (GRCm39) missense probably damaging 1.00
R1944:Ints6 UTSW 14 62,931,089 (GRCm39) missense probably benign 0.03
R2040:Ints6 UTSW 14 62,951,138 (GRCm39) missense probably damaging 0.99
R2279:Ints6 UTSW 14 62,942,131 (GRCm39) critical splice donor site probably null
R2844:Ints6 UTSW 14 62,942,275 (GRCm39) missense probably damaging 0.97
R3107:Ints6 UTSW 14 62,998,041 (GRCm39) missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62,934,386 (GRCm39) missense probably benign 0.00
R3895:Ints6 UTSW 14 62,934,060 (GRCm39) missense probably damaging 1.00
R4608:Ints6 UTSW 14 62,940,678 (GRCm39) missense probably damaging 1.00
R4903:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R4964:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R4966:Ints6 UTSW 14 62,939,911 (GRCm39) missense probably damaging 1.00
R5014:Ints6 UTSW 14 62,997,640 (GRCm39) missense probably benign 0.00
R5369:Ints6 UTSW 14 62,981,384 (GRCm39) missense probably damaging 1.00
R6478:Ints6 UTSW 14 62,938,235 (GRCm39) missense probably benign 0.37
R7022:Ints6 UTSW 14 62,951,786 (GRCm39) missense probably damaging 1.00
R7403:Ints6 UTSW 14 62,945,104 (GRCm39) missense possibly damaging 0.50
R7422:Ints6 UTSW 14 62,942,224 (GRCm39) missense probably benign
R7909:Ints6 UTSW 14 62,996,779 (GRCm39) missense probably damaging 0.99
R8147:Ints6 UTSW 14 62,951,186 (GRCm39) missense probably damaging 1.00
R8301:Ints6 UTSW 14 62,939,902 (GRCm39) missense probably benign
R8496:Ints6 UTSW 14 62,943,325 (GRCm39) missense probably benign 0.06
R8502:Ints6 UTSW 14 62,998,028 (GRCm39) missense possibly damaging 0.92
R8514:Ints6 UTSW 14 62,933,166 (GRCm39) missense possibly damaging 0.89
R8540:Ints6 UTSW 14 62,934,353 (GRCm39) missense probably benign 0.39
R8733:Ints6 UTSW 14 62,934,297 (GRCm39) missense probably benign 0.01
R8810:Ints6 UTSW 14 62,939,902 (GRCm39) missense probably benign 0.02
R8839:Ints6 UTSW 14 62,931,122 (GRCm39) missense probably benign 0.06
R9057:Ints6 UTSW 14 62,951,740 (GRCm39) critical splice donor site probably null
R9178:Ints6 UTSW 14 62,947,036 (GRCm39) missense probably damaging 1.00
R9318:Ints6 UTSW 14 62,934,147 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATCCCAACATTAACACATGCAATTT -3'
(R):5'- ctgagccatctctagcctcCTTAAGA -3'

Sequencing Primer
(F):5'- CTACAGGAATGTCAATGTTGTTTG -3'
(R):5'- cagaccatacatacgaccaaac -3'
Posted On 2014-01-29