Incidental Mutation 'R1254:Pcdhb16'
ID151400
Institutional Source Beutler Lab
Gene Symbol Pcdhb16
Ensembl Gene ENSMUSG00000047910
Gene Nameprotocadherin beta 16
SynonymsPcdhb8, PcdhbP
MMRRC Submission 039321-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1254 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37477814-37483038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37479295 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 436 (V436G)
Ref Sequence ENSEMBL: ENSMUSP00000056347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000050034
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000051442
AA Change: V436G

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910
AA Change: V436G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Coro2b A G 9: 62,428,965 L280P probably damaging Het
D430041D05Rik T G 2: 104,201,303 K1649N probably damaging Het
Duox2 T A 2: 122,283,478 H1191L probably damaging Het
Etl4 A G 2: 20,807,923 T1430A probably damaging Het
Hivep3 A G 4: 120,099,293 Y1602C probably damaging Het
Ints6 A G 14: 62,716,374 S180P probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Klhdc3 C T 17: 46,678,067 V66I probably benign Het
Olfr477 T A 7: 107,990,440 V25D probably benign Het
Pank1 T C 19: 34,840,860 H93R probably benign Het
Plekha6 G A 1: 133,272,589 R302H probably benign Het
Ptk2 C T 15: 73,229,970 R797Q probably benign Het
Rnase10 A T 14: 51,009,626 M117L probably damaging Het
Rnf151 A T 17: 24,717,552 C20* probably null Het
Robo4 T C 9: 37,410,840 probably null Het
Rps6ka5 G T 12: 100,619,529 H168Q probably damaging Het
Sstr1 G A 12: 58,213,322 V244M possibly damaging Het
Tmem147 A T 7: 30,729,370 Y17* probably null Het
Vmn1r7 A G 6: 57,024,787 C163R probably damaging Het
Other mutations in Pcdhb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pcdhb16 APN 18 37478570 missense possibly damaging 0.95
IGL00540:Pcdhb16 APN 18 37479798 missense probably damaging 1.00
IGL01380:Pcdhb16 APN 18 37479445 missense probably benign 0.30
IGL02043:Pcdhb16 APN 18 37479195 missense probably benign 0.05
IGL02103:Pcdhb16 APN 18 37480108 missense probably benign 0.19
IGL02151:Pcdhb16 APN 18 37478358 missense possibly damaging 0.80
IGL02619:Pcdhb16 APN 18 37478217 nonsense probably null
IGL02832:Pcdhb16 APN 18 37478474 missense probably damaging 1.00
IGL03190:Pcdhb16 APN 18 37479343 missense probably damaging 1.00
IGL03274:Pcdhb16 APN 18 37479232 missense probably benign 0.04
IGL03292:Pcdhb16 APN 18 37480384 missense probably damaging 0.99
R0076:Pcdhb16 UTSW 18 37478359 missense probably damaging 1.00
R0423:Pcdhb16 UTSW 18 37480369 missense probably benign 0.00
R1191:Pcdhb16 UTSW 18 37479873 missense probably damaging 1.00
R1417:Pcdhb16 UTSW 18 37478127 missense probably benign 0.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1468:Pcdhb16 UTSW 18 37478089 missense probably damaging 1.00
R1517:Pcdhb16 UTSW 18 37478098 missense probably benign 0.03
R1645:Pcdhb16 UTSW 18 37479370 missense probably benign 0.05
R1706:Pcdhb16 UTSW 18 37479652 missense probably benign 0.26
R1770:Pcdhb16 UTSW 18 37479180 missense probably damaging 1.00
R1809:Pcdhb16 UTSW 18 37478388 missense probably damaging 0.99
R1946:Pcdhb16 UTSW 18 37478899 nonsense probably null
R1967:Pcdhb16 UTSW 18 37479662 missense probably damaging 1.00
R2008:Pcdhb16 UTSW 18 37478263 missense probably damaging 1.00
R2220:Pcdhb16 UTSW 18 37478967 missense probably benign 0.16
R2432:Pcdhb16 UTSW 18 37479930 missense probably damaging 0.98
R3121:Pcdhb16 UTSW 18 37478218 missense possibly damaging 0.55
R3692:Pcdhb16 UTSW 18 37478287 missense probably benign 0.28
R3766:Pcdhb16 UTSW 18 37478196 nonsense probably null
R3891:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R3892:Pcdhb16 UTSW 18 37479369 missense probably benign 0.19
R4551:Pcdhb16 UTSW 18 37479834 missense probably damaging 1.00
R4614:Pcdhb16 UTSW 18 37480345 missense probably benign 0.22
R4716:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R4908:Pcdhb16 UTSW 18 37479841 unclassified probably null
R5185:Pcdhb16 UTSW 18 37480089 missense possibly damaging 0.96
R5225:Pcdhb16 UTSW 18 37479958 missense probably benign 0.02
R5422:Pcdhb16 UTSW 18 37479867 missense probably damaging 1.00
R5939:Pcdhb16 UTSW 18 37478064 missense probably benign
R6149:Pcdhb16 UTSW 18 37479155 missense possibly damaging 0.95
R6647:Pcdhb16 UTSW 18 37479172 missense possibly damaging 0.57
R7080:Pcdhb16 UTSW 18 37478463 nonsense probably null
R7354:Pcdhb16 UTSW 18 37478124 missense possibly damaging 0.79
R7413:Pcdhb16 UTSW 18 37478922 nonsense probably null
R7459:Pcdhb16 UTSW 18 37479553 missense probably benign 0.26
R7655:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7656:Pcdhb16 UTSW 18 37479405 missense probably benign 0.02
R7827:Pcdhb16 UTSW 18 37478851 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAAATGCACGATTCTGGCCCAAG -3'
(R):5'- TGAGCATTGGAGCCTGAGTCTGAG -3'

Sequencing Primer
(F):5'- TGTGAATGACCATGCTCCAG -3'
(R):5'- CTGAGTCTGAGTCTGTGGCAC -3'
Posted On2014-01-29