Incidental Mutation 'R1255:Aff3'
ID 151402
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene Name AF4/FMR2 family, member 3
Synonyms LAF-4, 3222402O04Rik, Laf4
MMRRC Submission 039322-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1255 (G1)
Quality Score 120
Status Not validated
Chromosome 1
Chromosomal Location 38216407-38704036 bp(-) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) A to T at 38243965 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027]
AlphaFold P51827
Predicted Effect probably null
Transcript: ENSMUST00000039827
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095027
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,807,016 (GRCm39) S21C probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Acsf3 T C 8: 123,512,705 (GRCm39) probably null Het
Antxr2 A T 5: 98,123,231 (GRCm39) I272N probably benign Het
Asphd2 A C 5: 112,539,677 (GRCm39) V52G probably damaging Het
Atxn3 T A 12: 101,900,593 (GRCm39) Q230L probably damaging Het
Bltp3b T C 10: 89,581,132 (GRCm39) I9T probably damaging Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Ciz1 T A 2: 32,255,888 (GRCm39) probably null Het
Dennd5b A T 6: 148,943,148 (GRCm39) M576K possibly damaging Het
Ebf3 C T 7: 136,826,941 (GRCm39) V315I probably benign Het
Epha5 G T 5: 84,298,254 (GRCm39) A383E probably damaging Het
Epha5 C T 5: 84,298,255 (GRCm39) A383T probably damaging Het
Gimap1 T A 6: 48,719,940 (GRCm39) V184E probably benign Het
Gtf2f1 A G 17: 57,317,982 (GRCm39) V18A probably damaging Het
Kcnn3 A T 3: 89,559,416 (GRCm39) D562V possibly damaging Het
Kif20b A G 19: 34,927,506 (GRCm39) T883A probably benign Het
Kmt2c A T 5: 25,556,151 (GRCm39) L1198Q probably damaging Het
Nipal2 T C 15: 34,584,828 (GRCm39) I247V probably benign Het
Or5ak22 T A 2: 85,230,647 (GRCm39) I77F probably damaging Het
Rad51ap2 G T 12: 11,508,095 (GRCm39) K672N possibly damaging Het
Rbm28 C T 6: 29,158,246 (GRCm39) G155D probably damaging Het
Sema6a A T 18: 47,382,366 (GRCm39) M701K probably damaging Het
Slc47a1 A T 11: 61,260,974 (GRCm39) L142Q probably damaging Het
Snx25 A T 8: 46,569,275 (GRCm39) N207K probably benign Het
Son T A 16: 91,461,583 (GRCm39) V205E probably damaging Het
Spz1 C A 13: 92,712,138 (GRCm39) V113F probably benign Het
Tcn2 T C 11: 3,872,120 (GRCm39) T336A probably benign Het
Tln1 T C 4: 43,538,044 (GRCm39) D1852G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Zfp729a T C 13: 67,769,965 (GRCm39) E88G probably benign Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38,574,762 (GRCm39) missense probably damaging 1.00
IGL02263:Aff3 APN 1 38,574,680 (GRCm39) missense probably damaging 1.00
IGL02962:Aff3 APN 1 38,574,737 (GRCm39) missense probably damaging 1.00
IGL03003:Aff3 APN 1 38,248,651 (GRCm39) missense probably damaging 1.00
IGL03180:Aff3 APN 1 38,574,743 (GRCm39) missense probably damaging 1.00
IGL03389:Aff3 APN 1 38,249,430 (GRCm39) missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38,578,044 (GRCm39) missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38,249,443 (GRCm39) missense probably benign 0.01
R0004:Aff3 UTSW 1 38,308,807 (GRCm39) missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38,308,807 (GRCm39) missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38,242,974 (GRCm39) missense probably benign 0.00
R0279:Aff3 UTSW 1 38,574,650 (GRCm39) missense probably damaging 1.00
R0344:Aff3 UTSW 1 38,243,013 (GRCm39) missense probably benign
R0375:Aff3 UTSW 1 38,244,021 (GRCm39) missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38,249,068 (GRCm39) missense probably damaging 1.00
R0613:Aff3 UTSW 1 38,249,004 (GRCm39) missense probably benign 0.09
R0742:Aff3 UTSW 1 38,666,189 (GRCm39) missense probably damaging 0.99
R1156:Aff3 UTSW 1 38,243,991 (GRCm39) missense probably benign
R1448:Aff3 UTSW 1 38,230,364 (GRCm39) missense probably damaging 1.00
R1760:Aff3 UTSW 1 38,368,945 (GRCm39) splice site probably benign
R1780:Aff3 UTSW 1 38,574,783 (GRCm39) missense probably damaging 1.00
R1855:Aff3 UTSW 1 38,249,385 (GRCm39) missense probably benign 0.23
R2011:Aff3 UTSW 1 38,246,996 (GRCm39) missense probably benign 0.01
R2331:Aff3 UTSW 1 38,243,971 (GRCm39) splice site probably null
R2965:Aff3 UTSW 1 38,248,791 (GRCm39) missense probably damaging 1.00
R2970:Aff3 UTSW 1 38,574,103 (GRCm39) missense probably damaging 0.97
R3015:Aff3 UTSW 1 38,249,649 (GRCm39) missense probably benign 0.00
R3763:Aff3 UTSW 1 38,291,770 (GRCm39) splice site probably benign
R4174:Aff3 UTSW 1 38,247,008 (GRCm39) missense probably damaging 0.96
R4436:Aff3 UTSW 1 38,248,768 (GRCm39) missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38,666,209 (GRCm39) missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38,220,694 (GRCm39) critical splice donor site probably null
R5566:Aff3 UTSW 1 38,220,505 (GRCm39) missense probably damaging 1.00
R6023:Aff3 UTSW 1 38,257,451 (GRCm39) missense probably damaging 1.00
R6209:Aff3 UTSW 1 38,232,670 (GRCm39) missense probably benign 0.28
R6467:Aff3 UTSW 1 38,247,098 (GRCm39) missense probably benign 0.25
R6748:Aff3 UTSW 1 38,574,327 (GRCm39) missense probably damaging 1.00
R6862:Aff3 UTSW 1 38,445,578 (GRCm39) missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38,666,209 (GRCm39) missense possibly damaging 0.94
R6880:Aff3 UTSW 1 38,574,243 (GRCm39) missense probably damaging 0.99
R7187:Aff3 UTSW 1 38,257,478 (GRCm39) missense probably damaging 0.98
R8322:Aff3 UTSW 1 38,220,742 (GRCm39) missense possibly damaging 0.65
R8329:Aff3 UTSW 1 38,244,135 (GRCm39) missense probably benign 0.13
R8737:Aff3 UTSW 1 38,308,810 (GRCm39) missense probably damaging 1.00
R9093:Aff3 UTSW 1 38,291,738 (GRCm39) missense possibly damaging 0.81
R9146:Aff3 UTSW 1 38,359,200 (GRCm39) missense probably benign 0.27
R9149:Aff3 UTSW 1 38,220,397 (GRCm39) missense probably damaging 1.00
R9157:Aff3 UTSW 1 38,249,559 (GRCm39) missense probably benign 0.45
R9446:Aff3 UTSW 1 38,574,337 (GRCm39) missense probably benign 0.30
R9581:Aff3 UTSW 1 38,249,266 (GRCm39) missense probably benign
R9645:Aff3 UTSW 1 38,249,121 (GRCm39) missense probably damaging 1.00
R9674:Aff3 UTSW 1 38,248,864 (GRCm39) missense probably damaging 1.00
Z1176:Aff3 UTSW 1 38,368,953 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCAAGCTGAGGACTTCTGCAC -3'
(R):5'- ATGAAAAGATGCTCCGGTCGCC -3'

Sequencing Primer
(F):5'- tctctctctctccccccc -3'
(R):5'- CCACTTCGCCACTCTCAGAC -3'
Posted On 2014-01-29