Incidental Mutation 'R1255:Olfr992'
ID151404
Institutional Source Beutler Lab
Gene Symbol Olfr992
Ensembl Gene ENSMUSG00000075221
Gene Nameolfactory receptor 992
SynonymsMOR203-1, GA_x6K02T2Q125-46877170-46876241
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85398824-85409469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85400303 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 77 (I77F)
Ref Sequence ENSEMBL: ENSMUSP00000149333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099927] [ENSMUST00000213749] [ENSMUST00000214895] [ENSMUST00000215617]
Predicted Effect probably damaging
Transcript: ENSMUST00000099927
AA Change: I77F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097511
Gene: ENSMUSG00000075221
AA Change: I77F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 285 3.3e-6 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213749
AA Change: I77F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000214895
AA Change: I77F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000215617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215967
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Olfr992
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Olfr992 APN 2 85400171 missense probably damaging 1.00
IGL02538:Olfr992 APN 2 85400303 missense probably damaging 1.00
IGL02550:Olfr992 APN 2 85399822 missense probably damaging 0.99
R0128:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0130:Olfr992 UTSW 2 85399961 missense probably damaging 0.99
R0345:Olfr992 UTSW 2 85400341 missense possibly damaging 0.60
R0413:Olfr992 UTSW 2 85399675 missense probably damaging 1.00
R0535:Olfr992 UTSW 2 85400095 missense possibly damaging 0.71
R1243:Olfr992 UTSW 2 85400273 missense probably benign
R1293:Olfr992 UTSW 2 85400353 splice site probably null
R1840:Olfr992 UTSW 2 85400168 missense probably benign 0.42
R1847:Olfr992 UTSW 2 85400441 missense probably damaging 0.99
R2300:Olfr992 UTSW 2 85400132 missense probably benign
R4574:Olfr992 UTSW 2 85400026 missense probably damaging 1.00
R4872:Olfr992 UTSW 2 85400428 missense probably damaging 1.00
R5435:Olfr992 UTSW 2 85400470 missense probably benign 0.05
R6846:Olfr992 UTSW 2 85400517 missense probably damaging 1.00
R7075:Olfr992 UTSW 2 85400200 missense probably damaging 1.00
R7253:Olfr992 UTSW 2 85399639 missense probably benign 0.00
R7454:Olfr992 UTSW 2 85399611 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCATAGTGTATGAACCAAGCAGCAG -3'
(R):5'- TGGTCAAAATGAGTCTTGGCACATCC -3'

Sequencing Primer
(F):5'- TCTCTGGGACATGATAATAGGATAGC -3'
(R):5'- TGGCACATCCTCTTTGTGG -3'
Posted On2014-01-29