Incidental Mutation 'R1255:Gimap1'
ID151415
Institutional Source Beutler Lab
Gene Symbol Gimap1
Ensembl Gene ENSMUSG00000090019
Gene NameGTPase, IMAP family member 1
SynonymsImap38, 38kDa, IAP38, imap
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R1255 (G1)
Quality Score171
Status Not validated
Chromosome6
Chromosomal Location48739054-48743795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48743006 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 184 (V184E)
Ref Sequence ENSEMBL: ENSMUSP00000145479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054368] [ENSMUST00000055558] [ENSMUST00000127537] [ENSMUST00000140054] [ENSMUST00000204168] [ENSMUST00000204408]
Predicted Effect probably benign
Transcript: ENSMUST00000054368
AA Change: V184E

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062108
Gene: ENSMUSG00000090019
AA Change: V184E

DomainStartEndE-ValueType
Pfam:AIG1 27 239 3.8e-81 PFAM
transmembrane domain 274 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055558
SMART Domains Protein: ENSMUSP00000056820
Gene: ENSMUSG00000043505

DomainStartEndE-ValueType
Pfam:AIG1 27 240 5.4e-80 PFAM
Pfam:MMR_HSR1 28 151 9.5e-8 PFAM
transmembrane domain 283 305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135174
Predicted Effect probably benign
Transcript: ENSMUST00000140054
SMART Domains Protein: ENSMUSP00000118345
Gene: ENSMUSG00000090019

DomainStartEndE-ValueType
Pfam:AIG1 27 74 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203797
Predicted Effect probably benign
Transcript: ENSMUST00000204168
AA Change: V184E

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145479
Gene: ENSMUSG00000090019
AA Change: V184E

DomainStartEndE-ValueType
Pfam:AIG1 27 239 3.8e-81 PFAM
transmembrane domain 274 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205172
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. Sequence analysis identified two alternatively spliced variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have defects in the development of mature B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Gimap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Gimap1 APN 6 48743324 missense probably damaging 0.99
vonnegut UTSW 6 48743098 missense probably damaging 1.00
R0555:Gimap1 UTSW 6 48741429 splice site probably benign
R0638:Gimap1 UTSW 6 48741425 splice site probably benign
R4043:Gimap1 UTSW 6 48743242 missense probably damaging 0.99
R5177:Gimap1 UTSW 6 48743098 missense probably damaging 1.00
R6076:Gimap1 UTSW 6 48742587 nonsense probably null
R6372:Gimap1 UTSW 6 48743356 makesense probably null
Z1176:Gimap1 UTSW 6 48743249 missense probably damaging 1.00
Z1176:Gimap1 UTSW 6 48743356 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATATCTTCAGCTCCGAGATCCCGC -3'
(R):5'- AGCCCTTCCAGTAGAATTTCCGCC -3'

Sequencing Primer
(F):5'- TCGCTTCACCATGCAGGAC -3'
(R):5'- AGTAGAATTTCCGCCATCCC -3'
Posted On2014-01-29