Incidental Mutation 'R1255:Dennd5b'
ID151416
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene NameDENN/MADD domain containing 5B
Synonyms9330160C06Rik, D030011O10Rik
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148988071-149101680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 149041650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 576 (M576K)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111557
AA Change: M576K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: M576K

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204583
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 149027330 missense probably damaging 1.00
IGL00590:Dennd5b APN 6 149068308 missense probably benign 0.03
IGL00727:Dennd5b APN 6 149006716 splice site probably benign
IGL00838:Dennd5b APN 6 149005363 splice site probably benign
IGL01115:Dennd5b APN 6 149009748 splice site probably benign
IGL01150:Dennd5b APN 6 149068085 missense probably benign 0.01
IGL01873:Dennd5b APN 6 149044529 missense probably benign
IGL01991:Dennd5b APN 6 149080824 missense probably damaging 1.00
IGL02226:Dennd5b APN 6 149033301 missense probably benign 0.00
IGL02820:Dennd5b APN 6 149019342 missense probably null 0.51
IGL03056:Dennd5b APN 6 149055072 missense probably damaging 1.00
IGL03085:Dennd5b APN 6 149027395 missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148998260 missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148993759 missense probably benign 0.13
R0617:Dennd5b UTSW 6 149033262 splice site probably benign
R1241:Dennd5b UTSW 6 149068490 missense probably benign 0.06
R1252:Dennd5b UTSW 6 149044487 missense probably damaging 1.00
R1641:Dennd5b UTSW 6 149068205 missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148998284 missense probably damaging 1.00
R1781:Dennd5b UTSW 6 149027398 missense probably damaging 1.00
R1861:Dennd5b UTSW 6 149068262 missense probably damaging 1.00
R1907:Dennd5b UTSW 6 149041576 missense probably benign 0.00
R2412:Dennd5b UTSW 6 149005238 missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149101217 missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 149044836 missense probably benign
R4581:Dennd5b UTSW 6 149016984 splice site silent
R4654:Dennd5b UTSW 6 149006837 missense probably damaging 1.00
R4725:Dennd5b UTSW 6 149044779 missense probably damaging 0.97
R4981:Dennd5b UTSW 6 149009772 missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 149041500 intron probably null
R5400:Dennd5b UTSW 6 149000016 missense probably damaging 1.00
R5452:Dennd5b UTSW 6 149041513 splice site probably null
R5548:Dennd5b UTSW 6 149019349 synonymous probably null
R5841:Dennd5b UTSW 6 149044755 missense probably benign 0.11
R5996:Dennd5b UTSW 6 149068095 missense probably benign 0.22
R6082:Dennd5b UTSW 6 149068695 missense probably damaging 0.99
R6556:Dennd5b UTSW 6 149014251 splice site probably null
R6812:Dennd5b UTSW 6 149081132 start gained probably benign
R6828:Dennd5b UTSW 6 148993746 missense probably damaging 0.99
R7104:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7231:Dennd5b UTSW 6 149044604 missense probably damaging 1.00
R7325:Dennd5b UTSW 6 149020570 missense probably benign 0.00
R7399:Dennd5b UTSW 6 149036483 missense probably damaging 1.00
R7516:Dennd5b UTSW 6 149068380 missense probably benign 0.02
R7751:Dennd5b UTSW 6 149017106 missense probably benign 0.01
R7763:Dennd5b UTSW 6 149068658 missense probably damaging 1.00
R7770:Dennd5b UTSW 6 149041716 missense probably damaging 0.99
R7788:Dennd5b UTSW 6 149068566 missense probably benign 0.00
R7854:Dennd5b UTSW 6 149068466 missense probably benign 0.00
R7899:Dennd5b UTSW 6 149041661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGATTCTCTTATACAGATGCCAAC -3'
(R):5'- TCCTCTATTCTCCATAACGGTCATCAGG -3'

Sequencing Primer
(F):5'- AGAGGACACCCTTCCTGATG -3'
(R):5'- AGCTCTAACTGGCCTAAAGTC -3'
Posted On2014-01-29