Incidental Mutation 'R1255:Uhrf1bp1l'
ID151423
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1l
Ensembl Gene ENSMUSG00000019951
Gene NameUHRF1 (ICBP90) binding protein 1-like
Synonyms4930506D01Rik, E030041M21Rik, 2010319N22Rik
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R1255 (G1)
Quality Score111
Status Not validated
Chromosome10
Chromosomal Location89744991-89819871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89745270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 9 (I9T)
Ref Sequence ENSEMBL: ENSMUSP00000020112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020112] [ENSMUST00000219712] [ENSMUST00000220375]
Predicted Effect probably damaging
Transcript: ENSMUST00000020112
AA Change: I9T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020112
Gene: ENSMUSG00000019951
AA Change: I9T

DomainStartEndE-ValueType
Pfam:Chorein_N 1 103 9.3e-21 PFAM
SCOP:d1c52__ 243 304 5e-3 SMART
low complexity region 788 801 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
coiled coil region 1410 1455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219712
AA Change: I9T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000220375
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Uhrf1bp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Uhrf1bp1l APN 10 89779984 missense probably damaging 1.00
IGL01102:Uhrf1bp1l APN 10 89791378 missense probably benign 0.00
IGL01457:Uhrf1bp1l APN 10 89805762 missense probably benign 0.06
IGL01647:Uhrf1bp1l APN 10 89774120 critical splice donor site probably null
IGL02552:Uhrf1bp1l APN 10 89806743 nonsense probably null
IGL02686:Uhrf1bp1l APN 10 89805193 missense probably benign
R0019:Uhrf1bp1l UTSW 10 89775969 missense probably damaging 1.00
R0505:Uhrf1bp1l UTSW 10 89791443 missense probably damaging 1.00
R0746:Uhrf1bp1l UTSW 10 89805454 missense probably benign 0.37
R1385:Uhrf1bp1l UTSW 10 89790641 missense possibly damaging 0.92
R1720:Uhrf1bp1l UTSW 10 89782586 missense probably damaging 1.00
R2142:Uhrf1bp1l UTSW 10 89812048 missense probably damaging 1.00
R2312:Uhrf1bp1l UTSW 10 89781133 missense probably damaging 0.99
R2986:Uhrf1bp1l UTSW 10 89806069 missense probably benign 0.00
R4063:Uhrf1bp1l UTSW 10 89816055 missense probably benign 0.38
R4278:Uhrf1bp1l UTSW 10 89806709 unclassified probably null
R4854:Uhrf1bp1l UTSW 10 89794484 missense probably damaging 1.00
R4857:Uhrf1bp1l UTSW 10 89779963 missense probably damaging 0.97
R5135:Uhrf1bp1l UTSW 10 89789355 missense probably damaging 1.00
R5467:Uhrf1bp1l UTSW 10 89805099 missense probably damaging 1.00
R5567:Uhrf1bp1l UTSW 10 89808521 missense probably benign 0.18
R5767:Uhrf1bp1l UTSW 10 89787199 missense possibly damaging 0.68
R6191:Uhrf1bp1l UTSW 10 89805318 missense possibly damaging 0.78
R6196:Uhrf1bp1l UTSW 10 89805333 missense probably benign 0.00
R6387:Uhrf1bp1l UTSW 10 89803057 nonsense probably null
R6729:Uhrf1bp1l UTSW 10 89805684 missense probably benign 0.01
R6746:Uhrf1bp1l UTSW 10 89787158 missense probably benign 0.19
R6794:Uhrf1bp1l UTSW 10 89805762 missense probably benign 0.06
R6892:Uhrf1bp1l UTSW 10 89805123 missense probably benign 0.02
R6990:Uhrf1bp1l UTSW 10 89806117 missense probably benign 0.12
R7188:Uhrf1bp1l UTSW 10 89779882 missense probably damaging 0.96
R7226:Uhrf1bp1l UTSW 10 89808641 missense probably benign 0.00
R7376:Uhrf1bp1l UTSW 10 89809656 missense probably damaging 1.00
R7836:Uhrf1bp1l UTSW 10 89816106 missense probably benign 0.00
R8188:Uhrf1bp1l UTSW 10 89812066 missense possibly damaging 0.50
X0060:Uhrf1bp1l UTSW 10 89805379 missense probably damaging 0.98
Z1177:Uhrf1bp1l UTSW 10 89812072 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCTTCTGAGAGTGATCTCTCCGGC -3'
(R):5'- CGATGCGGGACTGAAAACGACTTC -3'

Sequencing Primer
(F):5'- GTGATCTCTCCGGCGCTTC -3'
(R):5'- AGGTTAACGTTTCACTGGCAC -3'
Posted On2014-01-29